ID: 1067246787

View in Genome Browser
Species Human (GRCh38)
Location 10:44554099-44554121
Sequence ATGGAGCGGACTCAGTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067246787_1067246796 4 Left 1067246787 10:44554099-44554121 CCCCAGCACTGAGTCCGCTCCAT No data
Right 1067246796 10:44554126-44554148 ACCTGAGGGGAAGCCTCAAAGGG No data
1067246787_1067246791 -10 Left 1067246787 10:44554099-44554121 CCCCAGCACTGAGTCCGCTCCAT No data
Right 1067246791 10:44554112-44554134 TCCGCTCCATGCACACCTGAGGG No data
1067246787_1067246802 29 Left 1067246787 10:44554099-44554121 CCCCAGCACTGAGTCCGCTCCAT No data
Right 1067246802 10:44554151-44554173 GAACGTCCTGCAGGAGCAGGTGG No data
1067246787_1067246799 20 Left 1067246787 10:44554099-44554121 CCCCAGCACTGAGTCCGCTCCAT No data
Right 1067246799 10:44554142-44554164 CAAAGGGCCGAACGTCCTGCAGG No data
1067246787_1067246800 26 Left 1067246787 10:44554099-44554121 CCCCAGCACTGAGTCCGCTCCAT No data
Right 1067246800 10:44554148-44554170 GCCGAACGTCCTGCAGGAGCAGG No data
1067246787_1067246795 3 Left 1067246787 10:44554099-44554121 CCCCAGCACTGAGTCCGCTCCAT No data
Right 1067246795 10:44554125-44554147 CACCTGAGGGGAAGCCTCAAAGG No data
1067246787_1067246793 -9 Left 1067246787 10:44554099-44554121 CCCCAGCACTGAGTCCGCTCCAT No data
Right 1067246793 10:44554113-44554135 CCGCTCCATGCACACCTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067246787 Original CRISPR ATGGAGCGGACTCAGTGCTG GGG (reversed) Intergenic