ID: 1067246788

View in Genome Browser
Species Human (GRCh38)
Location 10:44554100-44554122
Sequence CATGGAGCGGACTCAGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067246788_1067246793 -10 Left 1067246788 10:44554100-44554122 CCCAGCACTGAGTCCGCTCCATG No data
Right 1067246793 10:44554113-44554135 CCGCTCCATGCACACCTGAGGGG No data
1067246788_1067246800 25 Left 1067246788 10:44554100-44554122 CCCAGCACTGAGTCCGCTCCATG No data
Right 1067246800 10:44554148-44554170 GCCGAACGTCCTGCAGGAGCAGG No data
1067246788_1067246796 3 Left 1067246788 10:44554100-44554122 CCCAGCACTGAGTCCGCTCCATG No data
Right 1067246796 10:44554126-44554148 ACCTGAGGGGAAGCCTCAAAGGG No data
1067246788_1067246795 2 Left 1067246788 10:44554100-44554122 CCCAGCACTGAGTCCGCTCCATG No data
Right 1067246795 10:44554125-44554147 CACCTGAGGGGAAGCCTCAAAGG No data
1067246788_1067246799 19 Left 1067246788 10:44554100-44554122 CCCAGCACTGAGTCCGCTCCATG No data
Right 1067246799 10:44554142-44554164 CAAAGGGCCGAACGTCCTGCAGG No data
1067246788_1067246802 28 Left 1067246788 10:44554100-44554122 CCCAGCACTGAGTCCGCTCCATG No data
Right 1067246802 10:44554151-44554173 GAACGTCCTGCAGGAGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067246788 Original CRISPR CATGGAGCGGACTCAGTGCT GGG (reversed) Intergenic