ID: 1067246789

View in Genome Browser
Species Human (GRCh38)
Location 10:44554101-44554123
Sequence GCATGGAGCGGACTCAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067246789_1067246795 1 Left 1067246789 10:44554101-44554123 CCAGCACTGAGTCCGCTCCATGC No data
Right 1067246795 10:44554125-44554147 CACCTGAGGGGAAGCCTCAAAGG No data
1067246789_1067246800 24 Left 1067246789 10:44554101-44554123 CCAGCACTGAGTCCGCTCCATGC No data
Right 1067246800 10:44554148-44554170 GCCGAACGTCCTGCAGGAGCAGG No data
1067246789_1067246799 18 Left 1067246789 10:44554101-44554123 CCAGCACTGAGTCCGCTCCATGC No data
Right 1067246799 10:44554142-44554164 CAAAGGGCCGAACGTCCTGCAGG No data
1067246789_1067246802 27 Left 1067246789 10:44554101-44554123 CCAGCACTGAGTCCGCTCCATGC No data
Right 1067246802 10:44554151-44554173 GAACGTCCTGCAGGAGCAGGTGG No data
1067246789_1067246796 2 Left 1067246789 10:44554101-44554123 CCAGCACTGAGTCCGCTCCATGC No data
Right 1067246796 10:44554126-44554148 ACCTGAGGGGAAGCCTCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067246789 Original CRISPR GCATGGAGCGGACTCAGTGC TGG (reversed) Intergenic