ID: 1067246790

View in Genome Browser
Species Human (GRCh38)
Location 10:44554111-44554133
Sequence GTCCGCTCCATGCACACCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067246785_1067246790 21 Left 1067246785 10:44554067-44554089 CCTGCTGGGTAGAGATGGGCAGT No data
Right 1067246790 10:44554111-44554133 GTCCGCTCCATGCACACCTGAGG No data
1067246786_1067246790 -3 Left 1067246786 10:44554091-44554113 CCACAATACCCCAGCACTGAGTC No data
Right 1067246790 10:44554111-44554133 GTCCGCTCCATGCACACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067246790 Original CRISPR GTCCGCTCCATGCACACCTG AGG Intergenic