ID: 1067246791

View in Genome Browser
Species Human (GRCh38)
Location 10:44554112-44554134
Sequence TCCGCTCCATGCACACCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067246786_1067246791 -2 Left 1067246786 10:44554091-44554113 CCACAATACCCCAGCACTGAGTC No data
Right 1067246791 10:44554112-44554134 TCCGCTCCATGCACACCTGAGGG No data
1067246785_1067246791 22 Left 1067246785 10:44554067-44554089 CCTGCTGGGTAGAGATGGGCAGT No data
Right 1067246791 10:44554112-44554134 TCCGCTCCATGCACACCTGAGGG No data
1067246787_1067246791 -10 Left 1067246787 10:44554099-44554121 CCCCAGCACTGAGTCCGCTCCAT No data
Right 1067246791 10:44554112-44554134 TCCGCTCCATGCACACCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067246791 Original CRISPR TCCGCTCCATGCACACCTGA GGG Intergenic