ID: 1067246791 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:44554112-44554134 |
| Sequence | TCCGCTCCATGCACACCTGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1067246786_1067246791 | -2 | Left | 1067246786 | 10:44554091-44554113 | CCACAATACCCCAGCACTGAGTC | No data | ||
| Right | 1067246791 | 10:44554112-44554134 | TCCGCTCCATGCACACCTGAGGG | No data | ||||
| 1067246785_1067246791 | 22 | Left | 1067246785 | 10:44554067-44554089 | CCTGCTGGGTAGAGATGGGCAGT | No data | ||
| Right | 1067246791 | 10:44554112-44554134 | TCCGCTCCATGCACACCTGAGGG | No data | ||||
| 1067246787_1067246791 | -10 | Left | 1067246787 | 10:44554099-44554121 | CCCCAGCACTGAGTCCGCTCCAT | No data | ||
| Right | 1067246791 | 10:44554112-44554134 | TCCGCTCCATGCACACCTGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1067246791 | Original CRISPR | TCCGCTCCATGCACACCTGA GGG | Intergenic | ||