ID: 1067246792

View in Genome Browser
Species Human (GRCh38)
Location 10:44554113-44554135
Sequence CCCCTCAGGTGTGCATGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067246792_1067246796 -10 Left 1067246792 10:44554113-44554135 CCGCTCCATGCACACCTGAGGGG No data
Right 1067246796 10:44554126-44554148 ACCTGAGGGGAAGCCTCAAAGGG No data
1067246792_1067246800 12 Left 1067246792 10:44554113-44554135 CCGCTCCATGCACACCTGAGGGG No data
Right 1067246800 10:44554148-44554170 GCCGAACGTCCTGCAGGAGCAGG No data
1067246792_1067246802 15 Left 1067246792 10:44554113-44554135 CCGCTCCATGCACACCTGAGGGG No data
Right 1067246802 10:44554151-44554173 GAACGTCCTGCAGGAGCAGGTGG No data
1067246792_1067246799 6 Left 1067246792 10:44554113-44554135 CCGCTCCATGCACACCTGAGGGG No data
Right 1067246799 10:44554142-44554164 CAAAGGGCCGAACGTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067246792 Original CRISPR CCCCTCAGGTGTGCATGGAG CGG (reversed) Intergenic