ID: 1067246796

View in Genome Browser
Species Human (GRCh38)
Location 10:44554126-44554148
Sequence ACCTGAGGGGAAGCCTCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067246786_1067246796 12 Left 1067246786 10:44554091-44554113 CCACAATACCCCAGCACTGAGTC No data
Right 1067246796 10:44554126-44554148 ACCTGAGGGGAAGCCTCAAAGGG No data
1067246789_1067246796 2 Left 1067246789 10:44554101-44554123 CCAGCACTGAGTCCGCTCCATGC No data
Right 1067246796 10:44554126-44554148 ACCTGAGGGGAAGCCTCAAAGGG No data
1067246787_1067246796 4 Left 1067246787 10:44554099-44554121 CCCCAGCACTGAGTCCGCTCCAT No data
Right 1067246796 10:44554126-44554148 ACCTGAGGGGAAGCCTCAAAGGG No data
1067246788_1067246796 3 Left 1067246788 10:44554100-44554122 CCCAGCACTGAGTCCGCTCCATG No data
Right 1067246796 10:44554126-44554148 ACCTGAGGGGAAGCCTCAAAGGG No data
1067246792_1067246796 -10 Left 1067246792 10:44554113-44554135 CCGCTCCATGCACACCTGAGGGG No data
Right 1067246796 10:44554126-44554148 ACCTGAGGGGAAGCCTCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067246796 Original CRISPR ACCTGAGGGGAAGCCTCAAA GGG Intergenic