ID: 1067246799

View in Genome Browser
Species Human (GRCh38)
Location 10:44554142-44554164
Sequence CAAAGGGCCGAACGTCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067246797_1067246799 -8 Left 1067246797 10:44554127-44554149 CCTGAGGGGAAGCCTCAAAGGGC No data
Right 1067246799 10:44554142-44554164 CAAAGGGCCGAACGTCCTGCAGG No data
1067246792_1067246799 6 Left 1067246792 10:44554113-44554135 CCGCTCCATGCACACCTGAGGGG No data
Right 1067246799 10:44554142-44554164 CAAAGGGCCGAACGTCCTGCAGG No data
1067246787_1067246799 20 Left 1067246787 10:44554099-44554121 CCCCAGCACTGAGTCCGCTCCAT No data
Right 1067246799 10:44554142-44554164 CAAAGGGCCGAACGTCCTGCAGG No data
1067246789_1067246799 18 Left 1067246789 10:44554101-44554123 CCAGCACTGAGTCCGCTCCATGC No data
Right 1067246799 10:44554142-44554164 CAAAGGGCCGAACGTCCTGCAGG No data
1067246788_1067246799 19 Left 1067246788 10:44554100-44554122 CCCAGCACTGAGTCCGCTCCATG No data
Right 1067246799 10:44554142-44554164 CAAAGGGCCGAACGTCCTGCAGG No data
1067246794_1067246799 1 Left 1067246794 10:44554118-44554140 CCATGCACACCTGAGGGGAAGCC No data
Right 1067246799 10:44554142-44554164 CAAAGGGCCGAACGTCCTGCAGG No data
1067246786_1067246799 28 Left 1067246786 10:44554091-44554113 CCACAATACCCCAGCACTGAGTC No data
Right 1067246799 10:44554142-44554164 CAAAGGGCCGAACGTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067246799 Original CRISPR CAAAGGGCCGAACGTCCTGC AGG Intergenic