ID: 1067246800

View in Genome Browser
Species Human (GRCh38)
Location 10:44554148-44554170
Sequence GCCGAACGTCCTGCAGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067246789_1067246800 24 Left 1067246789 10:44554101-44554123 CCAGCACTGAGTCCGCTCCATGC No data
Right 1067246800 10:44554148-44554170 GCCGAACGTCCTGCAGGAGCAGG No data
1067246787_1067246800 26 Left 1067246787 10:44554099-44554121 CCCCAGCACTGAGTCCGCTCCAT No data
Right 1067246800 10:44554148-44554170 GCCGAACGTCCTGCAGGAGCAGG No data
1067246797_1067246800 -2 Left 1067246797 10:44554127-44554149 CCTGAGGGGAAGCCTCAAAGGGC No data
Right 1067246800 10:44554148-44554170 GCCGAACGTCCTGCAGGAGCAGG No data
1067246792_1067246800 12 Left 1067246792 10:44554113-44554135 CCGCTCCATGCACACCTGAGGGG No data
Right 1067246800 10:44554148-44554170 GCCGAACGTCCTGCAGGAGCAGG No data
1067246794_1067246800 7 Left 1067246794 10:44554118-44554140 CCATGCACACCTGAGGGGAAGCC No data
Right 1067246800 10:44554148-44554170 GCCGAACGTCCTGCAGGAGCAGG No data
1067246788_1067246800 25 Left 1067246788 10:44554100-44554122 CCCAGCACTGAGTCCGCTCCATG No data
Right 1067246800 10:44554148-44554170 GCCGAACGTCCTGCAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067246800 Original CRISPR GCCGAACGTCCTGCAGGAGC AGG Intergenic