ID: 1067250382

View in Genome Browser
Species Human (GRCh38)
Location 10:44581611-44581633
Sequence TTCACCCCATCCCAGAGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067250380_1067250382 -4 Left 1067250380 10:44581592-44581614 CCTAATATTTTTTGGATTTTTCA No data
Right 1067250382 10:44581611-44581633 TTCACCCCATCCCAGAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067250382 Original CRISPR TTCACCCCATCCCAGAGGAC AGG Intergenic
No off target data available for this crispr