ID: 1067260929

View in Genome Browser
Species Human (GRCh38)
Location 10:44690830-44690852
Sequence CAGTTGCAGCAGTTTTACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067260929_1067260934 -8 Left 1067260929 10:44690830-44690852 CCCTGGTAAAACTGCTGCAACTG No data
Right 1067260934 10:44690845-44690867 TGCAACTGAGCTAGGGGTAGAGG No data
1067260929_1067260938 11 Left 1067260929 10:44690830-44690852 CCCTGGTAAAACTGCTGCAACTG No data
Right 1067260938 10:44690864-44690886 GAGGGAATGGGAGCAGACCCTGG No data
1067260929_1067260936 -2 Left 1067260929 10:44690830-44690852 CCCTGGTAAAACTGCTGCAACTG No data
Right 1067260936 10:44690851-44690873 TGAGCTAGGGGTAGAGGGAATGG No data
1067260929_1067260937 -1 Left 1067260929 10:44690830-44690852 CCCTGGTAAAACTGCTGCAACTG No data
Right 1067260937 10:44690852-44690874 GAGCTAGGGGTAGAGGGAATGGG No data
1067260929_1067260935 -7 Left 1067260929 10:44690830-44690852 CCCTGGTAAAACTGCTGCAACTG No data
Right 1067260935 10:44690846-44690868 GCAACTGAGCTAGGGGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067260929 Original CRISPR CAGTTGCAGCAGTTTTACCA GGG (reversed) Intergenic
No off target data available for this crispr