ID: 1067266578

View in Genome Browser
Species Human (GRCh38)
Location 10:44750735-44750757
Sequence GTGGTTATAAAAGGGCCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067266565_1067266578 22 Left 1067266565 10:44750690-44750712 CCCAGGTATTATGAATGGGGGGA No data
Right 1067266578 10:44750735-44750757 GTGGTTATAAAAGGGCCACAAGG No data
1067266566_1067266578 21 Left 1067266566 10:44750691-44750713 CCAGGTATTATGAATGGGGGGAG No data
Right 1067266578 10:44750735-44750757 GTGGTTATAAAAGGGCCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067266578 Original CRISPR GTGGTTATAAAAGGGCCACA AGG Intergenic
No off target data available for this crispr