ID: 1067268110

View in Genome Browser
Species Human (GRCh38)
Location 10:44764994-44765016
Sequence AGAATGTATCTGGCCATATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067268110_1067268118 15 Left 1067268110 10:44764994-44765016 CCCCATATGGCCAGATACATTCT No data
Right 1067268118 10:44765032-44765054 GAGCTCAGAGGACAAATGAATGG No data
1067268110_1067268115 3 Left 1067268110 10:44764994-44765016 CCCCATATGGCCAGATACATTCT No data
Right 1067268115 10:44765020-44765042 TCCTCACCTGTTGAGCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067268110 Original CRISPR AGAATGTATCTGGCCATATG GGG (reversed) Intergenic
No off target data available for this crispr