ID: 1067268349

View in Genome Browser
Species Human (GRCh38)
Location 10:44767133-44767155
Sequence CTGTGGCTTTGGAGATAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067268343_1067268349 -6 Left 1067268343 10:44767116-44767138 CCCTCGGACTAAGATACCTGTGG No data
Right 1067268349 10:44767133-44767155 CTGTGGCTTTGGAGATAAGAGGG No data
1067268342_1067268349 -3 Left 1067268342 10:44767113-44767135 CCACCCTCGGACTAAGATACCTG No data
Right 1067268349 10:44767133-44767155 CTGTGGCTTTGGAGATAAGAGGG No data
1067268345_1067268349 -7 Left 1067268345 10:44767117-44767139 CCTCGGACTAAGATACCTGTGGC No data
Right 1067268349 10:44767133-44767155 CTGTGGCTTTGGAGATAAGAGGG No data
1067268341_1067268349 -2 Left 1067268341 10:44767112-44767134 CCCACCCTCGGACTAAGATACCT No data
Right 1067268349 10:44767133-44767155 CTGTGGCTTTGGAGATAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067268349 Original CRISPR CTGTGGCTTTGGAGATAAGA GGG Intergenic
No off target data available for this crispr