ID: 1067269726

View in Genome Browser
Species Human (GRCh38)
Location 10:44779897-44779919
Sequence TGCTGACCTCCTCCTACGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067269726_1067269734 14 Left 1067269726 10:44779897-44779919 CCTCCCGTAGGAGGAGGTCAGCA No data
Right 1067269734 10:44779934-44779956 TGACTGCCCGACTCTCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067269726 Original CRISPR TGCTGACCTCCTCCTACGGG AGG (reversed) Intergenic
No off target data available for this crispr