ID: 1067272579

View in Genome Browser
Species Human (GRCh38)
Location 10:44805044-44805066
Sequence CTGACCACACTGGACACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067272576_1067272579 0 Left 1067272576 10:44805021-44805043 CCTTTTCATTCAGTAGCTATTTC No data
Right 1067272579 10:44805044-44805066 CTGACCACACTGGACACAGAAGG No data
1067272574_1067272579 25 Left 1067272574 10:44804996-44805018 CCATTATTGATCCATTAATCTAT No data
Right 1067272579 10:44805044-44805066 CTGACCACACTGGACACAGAAGG No data
1067272575_1067272579 14 Left 1067272575 10:44805007-44805029 CCATTAATCTATTTCCTTTTCAT No data
Right 1067272579 10:44805044-44805066 CTGACCACACTGGACACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067272579 Original CRISPR CTGACCACACTGGACACAGA AGG Intergenic