ID: 1067277145

View in Genome Browser
Species Human (GRCh38)
Location 10:44845970-44845992
Sequence CCTGGTAAGCAGACAGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067277145_1067277158 24 Left 1067277145 10:44845970-44845992 CCTGGCACTGTCTGCTTACCAGG No data
Right 1067277158 10:44846017-44846039 AAGGTGTGGAGCACTGGACAAGG No data
1067277145_1067277156 18 Left 1067277145 10:44845970-44845992 CCTGGCACTGTCTGCTTACCAGG No data
Right 1067277156 10:44846011-44846033 GGAACCAAGGTGTGGAGCACTGG No data
1067277145_1067277153 5 Left 1067277145 10:44845970-44845992 CCTGGCACTGTCTGCTTACCAGG No data
Right 1067277153 10:44845998-44846020 GGCCAGACAAAGGGGAACCAAGG No data
1067277145_1067277149 -5 Left 1067277145 10:44845970-44845992 CCTGGCACTGTCTGCTTACCAGG No data
Right 1067277149 10:44845988-44846010 CCAGGAGCCAGGCCAGACAAAGG No data
1067277145_1067277151 -3 Left 1067277145 10:44845970-44845992 CCTGGCACTGTCTGCTTACCAGG No data
Right 1067277151 10:44845990-44846012 AGGAGCCAGGCCAGACAAAGGGG No data
1067277145_1067277155 10 Left 1067277145 10:44845970-44845992 CCTGGCACTGTCTGCTTACCAGG No data
Right 1067277155 10:44846003-44846025 GACAAAGGGGAACCAAGGTGTGG No data
1067277145_1067277150 -4 Left 1067277145 10:44845970-44845992 CCTGGCACTGTCTGCTTACCAGG No data
Right 1067277150 10:44845989-44846011 CAGGAGCCAGGCCAGACAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067277145 Original CRISPR CCTGGTAAGCAGACAGTGCC AGG (reversed) Intergenic
No off target data available for this crispr