ID: 1067277283

View in Genome Browser
Species Human (GRCh38)
Location 10:44846825-44846847
Sequence GATCCAGAGGCAGATCCGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067277283_1067277289 3 Left 1067277283 10:44846825-44846847 CCCAACGGATCTGCCTCTGGATC No data
Right 1067277289 10:44846851-44846873 CTCCACAATGCTCTTAGGTTTGG No data
1067277283_1067277286 -2 Left 1067277283 10:44846825-44846847 CCCAACGGATCTGCCTCTGGATC No data
Right 1067277286 10:44846846-44846868 TCCACCTCCACAATGCTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067277283 Original CRISPR GATCCAGAGGCAGATCCGTT GGG (reversed) Intergenic
No off target data available for this crispr