ID: 1067278088

View in Genome Browser
Species Human (GRCh38)
Location 10:44851978-44852000
Sequence CAGGGCAGGGAGAATGCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067278075_1067278088 14 Left 1067278075 10:44851941-44851963 CCAAGGTGGATGGTAGGGGCCTG No data
Right 1067278088 10:44851978-44852000 CAGGGCAGGGAGAATGCAGCCGG No data
1067278066_1067278088 29 Left 1067278066 10:44851926-44851948 CCCCCGCACAGTGGGCCAAGGTG No data
Right 1067278088 10:44851978-44852000 CAGGGCAGGGAGAATGCAGCCGG No data
1067278069_1067278088 27 Left 1067278069 10:44851928-44851950 CCCGCACAGTGGGCCAAGGTGGA No data
Right 1067278088 10:44851978-44852000 CAGGGCAGGGAGAATGCAGCCGG No data
1067278081_1067278088 -5 Left 1067278081 10:44851960-44851982 CCTGGAGAAGGGGCCACCCAGGG No data
Right 1067278088 10:44851978-44852000 CAGGGCAGGGAGAATGCAGCCGG No data
1067278070_1067278088 26 Left 1067278070 10:44851929-44851951 CCGCACAGTGGGCCAAGGTGGAT No data
Right 1067278088 10:44851978-44852000 CAGGGCAGGGAGAATGCAGCCGG No data
1067278067_1067278088 28 Left 1067278067 10:44851927-44851949 CCCCGCACAGTGGGCCAAGGTGG No data
Right 1067278088 10:44851978-44852000 CAGGGCAGGGAGAATGCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067278088 Original CRISPR CAGGGCAGGGAGAATGCAGC CGG Intergenic
No off target data available for this crispr