ID: 1067278455

View in Genome Browser
Species Human (GRCh38)
Location 10:44853968-44853990
Sequence GTGGGCAGCAAGCCTTAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067278455_1067278467 29 Left 1067278455 10:44853968-44853990 CCAATTTAAGGCTTGCTGCCCAC No data
Right 1067278467 10:44854020-44854042 GGCCAGCGGAAGCCCCGTGAAGG No data
1067278455_1067278462 8 Left 1067278455 10:44853968-44853990 CCAATTTAAGGCTTGCTGCCCAC No data
Right 1067278462 10:44853999-44854021 TTTGGACGAGCTCTTCCCCAGGG No data
1067278455_1067278461 7 Left 1067278455 10:44853968-44853990 CCAATTTAAGGCTTGCTGCCCAC No data
Right 1067278461 10:44853998-44854020 CTTTGGACGAGCTCTTCCCCAGG No data
1067278455_1067278458 -10 Left 1067278455 10:44853968-44853990 CCAATTTAAGGCTTGCTGCCCAC No data
Right 1067278458 10:44853981-44854003 TGCTGCCCACTCTGGGTCTTTGG No data
1067278455_1067278463 15 Left 1067278455 10:44853968-44853990 CCAATTTAAGGCTTGCTGCCCAC No data
Right 1067278463 10:44854006-44854028 GAGCTCTTCCCCAGGGCCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067278455 Original CRISPR GTGGGCAGCAAGCCTTAAAT TGG (reversed) Intergenic
No off target data available for this crispr