ID: 1067278459

View in Genome Browser
Species Human (GRCh38)
Location 10:44853986-44854008
Sequence CTCGTCCAAAGACCCAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067278459_1067278462 -10 Left 1067278459 10:44853986-44854008 CCCACTCTGGGTCTTTGGACGAG No data
Right 1067278462 10:44853999-44854021 TTTGGACGAGCTCTTCCCCAGGG No data
1067278459_1067278467 11 Left 1067278459 10:44853986-44854008 CCCACTCTGGGTCTTTGGACGAG No data
Right 1067278467 10:44854020-44854042 GGCCAGCGGAAGCCCCGTGAAGG No data
1067278459_1067278463 -3 Left 1067278459 10:44853986-44854008 CCCACTCTGGGTCTTTGGACGAG No data
Right 1067278463 10:44854006-44854028 GAGCTCTTCCCCAGGGCCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067278459 Original CRISPR CTCGTCCAAAGACCCAGAGT GGG (reversed) Intergenic
No off target data available for this crispr