ID: 1067278460

View in Genome Browser
Species Human (GRCh38)
Location 10:44853987-44854009
Sequence GCTCGTCCAAAGACCCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067278460_1067278463 -4 Left 1067278460 10:44853987-44854009 CCACTCTGGGTCTTTGGACGAGC No data
Right 1067278463 10:44854006-44854028 GAGCTCTTCCCCAGGGCCAGCGG No data
1067278460_1067278467 10 Left 1067278460 10:44853987-44854009 CCACTCTGGGTCTTTGGACGAGC No data
Right 1067278467 10:44854020-44854042 GGCCAGCGGAAGCCCCGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067278460 Original CRISPR GCTCGTCCAAAGACCCAGAG TGG (reversed) Intergenic
No off target data available for this crispr