ID: 1067278467

View in Genome Browser
Species Human (GRCh38)
Location 10:44854020-44854042
Sequence GGCCAGCGGAAGCCCCGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067278460_1067278467 10 Left 1067278460 10:44853987-44854009 CCACTCTGGGTCTTTGGACGAGC No data
Right 1067278467 10:44854020-44854042 GGCCAGCGGAAGCCCCGTGAAGG No data
1067278459_1067278467 11 Left 1067278459 10:44853986-44854008 CCCACTCTGGGTCTTTGGACGAG No data
Right 1067278467 10:44854020-44854042 GGCCAGCGGAAGCCCCGTGAAGG No data
1067278455_1067278467 29 Left 1067278455 10:44853968-44853990 CCAATTTAAGGCTTGCTGCCCAC No data
Right 1067278467 10:44854020-44854042 GGCCAGCGGAAGCCCCGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067278467 Original CRISPR GGCCAGCGGAAGCCCCGTGA AGG Intergenic
No off target data available for this crispr