ID: 1067279487

View in Genome Browser
Species Human (GRCh38)
Location 10:44860647-44860669
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067279486_1067279487 -6 Left 1067279486 10:44860630-44860652 CCTTTGAAGAGGGCTGCACAGTC No data
Right 1067279487 10:44860647-44860669 ACAGTCTCCCAGCTGACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067279487 Original CRISPR ACAGTCTCCCAGCTGACCTC AGG Intergenic
No off target data available for this crispr