ID: 1067281153

View in Genome Browser
Species Human (GRCh38)
Location 10:44874215-44874237
Sequence TATGTTATTAAAGCTGTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067281151_1067281153 7 Left 1067281151 10:44874185-44874207 CCATACATCTCACTTGCAGAAAT No data
Right 1067281153 10:44874215-44874237 TATGTTATTAAAGCTGTTTCAGG No data
1067281150_1067281153 8 Left 1067281150 10:44874184-44874206 CCCATACATCTCACTTGCAGAAA No data
Right 1067281153 10:44874215-44874237 TATGTTATTAAAGCTGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067281153 Original CRISPR TATGTTATTAAAGCTGTTTC AGG Intergenic
No off target data available for this crispr