ID: 1067284112

View in Genome Browser
Species Human (GRCh38)
Location 10:44894971-44894993
Sequence TGGGCACAGCGCTGGGCCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067284112_1067284121 17 Left 1067284112 10:44894971-44894993 CCGCGGGCCCAGCGCTGTGCCCA No data
Right 1067284121 10:44895011-44895033 CTTCATTCAGCAGTGACCATGGG No data
1067284112_1067284120 16 Left 1067284112 10:44894971-44894993 CCGCGGGCCCAGCGCTGTGCCCA No data
Right 1067284120 10:44895010-44895032 TCTTCATTCAGCAGTGACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067284112 Original CRISPR TGGGCACAGCGCTGGGCCCG CGG (reversed) Intergenic
No off target data available for this crispr