ID: 1067285583

View in Genome Browser
Species Human (GRCh38)
Location 10:44905420-44905442
Sequence GTTTCAAGTTACCAGGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067285583_1067285586 10 Left 1067285583 10:44905420-44905442 CCTGACACCTGGTAACTTGAAAC No data
Right 1067285586 10:44905453-44905475 TATTATCTCACAGTTTCTCAGGG No data
1067285583_1067285585 9 Left 1067285583 10:44905420-44905442 CCTGACACCTGGTAACTTGAAAC No data
Right 1067285585 10:44905452-44905474 CTATTATCTCACAGTTTCTCAGG No data
1067285583_1067285588 18 Left 1067285583 10:44905420-44905442 CCTGACACCTGGTAACTTGAAAC No data
Right 1067285588 10:44905461-44905483 CACAGTTTCTCAGGGTACCTGGG No data
1067285583_1067285587 17 Left 1067285583 10:44905420-44905442 CCTGACACCTGGTAACTTGAAAC No data
Right 1067285587 10:44905460-44905482 TCACAGTTTCTCAGGGTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067285583 Original CRISPR GTTTCAAGTTACCAGGTGTC AGG (reversed) Intergenic
No off target data available for this crispr