ID: 1067288410

View in Genome Browser
Species Human (GRCh38)
Location 10:44924147-44924169
Sequence CATGTGGATCAAGGCGACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067288410_1067288419 21 Left 1067288410 10:44924147-44924169 CCACAGTCGCCTTGATCCACATG 0: 1
1: 0
2: 2
3: 3
4: 78
Right 1067288419 10:44924191-44924213 GTGCCCCTGCTTCTGCTGTTAGG No data
1067288410_1067288420 22 Left 1067288410 10:44924147-44924169 CCACAGTCGCCTTGATCCACATG 0: 1
1: 0
2: 2
3: 3
4: 78
Right 1067288420 10:44924192-44924214 TGCCCCTGCTTCTGCTGTTAGGG No data
1067288410_1067288421 23 Left 1067288410 10:44924147-44924169 CCACAGTCGCCTTGATCCACATG 0: 1
1: 0
2: 2
3: 3
4: 78
Right 1067288421 10:44924193-44924215 GCCCCTGCTTCTGCTGTTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067288410 Original CRISPR CATGTGGATCAAGGCGACTG TGG (reversed) Intronic
907325067 1:53632416-53632438 CATGTGGATGAATATGACTGAGG + Intronic
919211355 1:194491302-194491324 CATGTGGAACAATGTGTCTGAGG + Intergenic
920166720 1:204041384-204041406 CAAGTGGAACAGGGGGACTGGGG + Intergenic
923774270 1:236964400-236964422 CATGGGGATCAAGATCACTGGGG - Intergenic
1067288410 10:44924147-44924169 CATGTGGATCAAGGCGACTGTGG - Intronic
1068169739 10:53377993-53378015 CATGTGCATCAGAGTGACTGTGG + Intergenic
1075487100 10:122831535-122831557 CATGTGAATCAAGGAGACTGCGG + Intergenic
1075928723 10:126274726-126274748 CATGTTGAAGAGGGCGACTGAGG - Intronic
1076689419 10:132213891-132213913 CATCTGGATCCAGTCTACTGAGG - Intronic
1078483932 11:11704656-11704678 CATGTGGTTCCTGGCAACTGTGG + Intergenic
1080316413 11:30955271-30955293 TATGTGCTTCAAAGCGACTGGGG - Intronic
1102492226 12:113296354-113296376 CACCTGGATCCAGTCGACTGCGG + Exonic
1104856224 12:131903674-131903696 CAGGTGACTCAAGGCCACTGGGG - Intronic
1107845514 13:44508742-44508764 CATGGGGAGCAAGGGGACAGTGG - Intronic
1111958162 13:94780755-94780777 GATTTGGATCAAGGAGATTGTGG - Intergenic
1114143223 14:19941605-19941627 CCTGTGGATCATGGAGACTCAGG + Intergenic
1117953504 14:61105136-61105158 CAAGTGGATCAAGGCTACTGTGG - Intergenic
1120827315 14:88967628-88967650 CATGTGGATGAAGCCTACTTGGG + Intergenic
1120912809 14:89683016-89683038 TATGTGGATCAATGAGCCTGAGG + Intergenic
1122218967 14:100223003-100223025 CCTGTGGTTCAAGGGGACCGGGG + Intergenic
1125834502 15:42737319-42737341 AATGTGGATCACAGCGCCTGGGG + Intergenic
1126416905 15:48427376-48427398 CAAGTGGACCAAGGCCACTTTGG + Intronic
1141303245 16:82837468-82837490 CTTGGGGATCAAGGAAACTGGGG - Intronic
1142326138 16:89415899-89415921 CATGTGGGTCACGGCGCCTCTGG + Intronic
1142765742 17:2063291-2063313 CATGTGGATTATGGCGGATGGGG - Intronic
1153333846 18:3901613-3901635 CATGAGGATGTAGGGGACTGTGG - Intronic
1154461251 18:14590106-14590128 CATGTGGATCACGGAGACTCAGG + Intergenic
1164026679 19:21359280-21359302 CTTATGGCTGAAGGCGACTGAGG - Intronic
1166992724 19:46702656-46702678 TATGTGGATCTAGGCTTCTGAGG + Intronic
925737265 2:6974409-6974431 CATTTGGTACAAGGAGACTGGGG - Intronic
926999857 2:18783368-18783390 CATGTTGCTCAAGGGCACTGGGG - Intergenic
927077854 2:19597935-19597957 CATGTGTCTCCAGGGGACTGGGG - Intergenic
927212518 2:20647371-20647393 CAAGTGGCTCAACGTGACTGGGG + Intronic
929994780 2:46818445-46818467 CATGGGGATCCAGGCCACAGCGG - Intronic
930136651 2:47908802-47908824 CATGAGGATCAAGGGACCTGTGG - Intergenic
935690062 2:105723052-105723074 CCTGTGGATCCAGGTCACTGTGG + Intergenic
939520938 2:143229851-143229873 CTTGGGGATAAAGGCTACTGCGG - Intronic
941379953 2:164780170-164780192 GATGTGGATCTAGGAGAATGAGG - Intronic
944063641 2:195596033-195596055 CATCTGGATCAAGCACACTGAGG + Intronic
947711932 2:232321447-232321469 CATGTGGGCCAAGGCATCTGAGG + Intronic
947835219 2:233170251-233170273 CATGTGAATCAAGTGGGCTGAGG + Intronic
1172158086 20:32843726-32843748 CATGTGGTTGATGGCTACTGTGG + Intronic
1174337684 20:49874765-49874787 CATGAGGATCTGGGTGACTGGGG - Exonic
1176813256 21:13567742-13567764 CATGTGGATCACGGAGACTCAGG - Intergenic
954664972 3:52246723-52246745 AATGAGGATCAAGCCGCCTGTGG + Exonic
954972963 3:54666773-54666795 CATGTGATTCAGGGTGACTGGGG + Intronic
958919640 3:100090193-100090215 CATGTGGACAAAGGTGCCTGGGG - Intronic
965145842 3:164902494-164902516 TATGTGTTTCAAGGCAACTGTGG - Intergenic
965363992 3:167776148-167776170 CATGTGGCCCAAGGCCATTGTGG - Intronic
966097328 3:176220083-176220105 AATATGCATCAAGGAGACTGGGG + Intergenic
966777974 3:183559598-183559620 CAGGTGAATGAAGGAGACTGAGG + Intergenic
966912352 3:184566520-184566542 CGTGAGGATCAAGGCGTCTTGGG - Intronic
968447457 4:658890-658912 CATGTGGGACAAGGTGACGGCGG - Intronic
970505343 4:16723652-16723674 CACGTGGCTCCAGGGGACTGTGG - Intronic
970943514 4:21663269-21663291 AATGTGTATCAAGGTGATTGTGG + Intronic
971354303 4:25880635-25880657 CATGTTCATCATGGTGACTGTGG - Intronic
975725802 4:77290669-77290691 CATGTGGATCTAGGTGAGTCAGG - Intronic
976945950 4:90768045-90768067 CATGTGGAGCAAGTCAACAGGGG - Intronic
981707174 4:147672075-147672097 CAAGTGGAACAAGACAACTGAGG + Intronic
987491323 5:18583489-18583511 CGAGTGGGTCAAGGAGACTGGGG + Intergenic
988112275 5:26837849-26837871 GATGTAGATAAAGGAGACTGGGG + Intergenic
990501504 5:56400934-56400956 TATGTAGATCAAGGTGAATGAGG - Intergenic
994734899 5:103540489-103540511 CATGTGGCTCAAGTCAACTGTGG - Intergenic
999431228 5:151527144-151527166 CATGTGGACTAATGCCACTGAGG + Intronic
1002809300 6:611390-611412 CCTGTGGAGCAGGGCTACTGTGG - Intronic
1003744365 6:8983088-8983110 GATTTGGATCAAAGCTACTGCGG + Intergenic
1004187441 6:13433025-13433047 CATGTTGATCATGTAGACTGGGG - Intronic
1015851319 6:137575525-137575547 CCTGTAGATCAAGGAGGCTGGGG - Intergenic
1019254860 7:42969-42991 AACGTGGATCATGGCTACTGTGG - Intergenic
1021353193 7:19620799-19620821 CTTGTGCATCAAGCCGACTTTGG + Intergenic
1027483530 7:78729612-78729634 CATGTGGATGAGGGCCATTGTGG - Intronic
1029465600 7:100722778-100722800 CATGTGGATAAAGCCGTCAGTGG + Exonic
1036124930 8:6053740-6053762 CAGGTGGACCCAGGCAACTGGGG - Intergenic
1048278629 8:133088127-133088149 CATGTGAATCAAAGCAACTTGGG + Intronic
1048860860 8:138723829-138723851 AATGTGGATCAAGGCGCCCAGGG - Intronic
1054825579 9:69569628-69569650 CATATGGTTGAAGGTGACTGAGG + Intronic
1056170494 9:83980323-83980345 CACGTCAATCAAGGCGACGGAGG + Intronic
1057214236 9:93219253-93219275 CATGTTGACCAATGGGACTGGGG - Intronic
1060311743 9:122468692-122468714 CTTGTTAGTCAAGGCGACTGAGG + Intergenic
1188452111 X:30318279-30318301 CATGTGGCTCAAGGTAACAGAGG - Intergenic
1188646784 X:32578618-32578640 CATTTGGATAAAGGTAACTGAGG + Intronic
1192369007 X:70498127-70498149 CATGTTGATGAAGGGGACTCGGG + Intronic
1195498955 X:105571559-105571581 CATGTGGATGAGGGCAACAGAGG - Intronic
1201573784 Y:15440554-15440576 CATGTGGATCAAAACGACCTTGG - Intergenic