ID: 1067289619

View in Genome Browser
Species Human (GRCh38)
Location 10:44931687-44931709
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067289611_1067289619 15 Left 1067289611 10:44931649-44931671 CCAGGTTTAAGGCTGGAACACAG 0: 1
1: 0
2: 1
3: 11
4: 120
Right 1067289619 10:44931687-44931709 CCTGGTGACCAGCAGGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr