ID: 1067294246

View in Genome Browser
Species Human (GRCh38)
Location 10:44965722-44965744
Sequence GGGCACACCATCCCAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 216}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067294246 Original CRISPR GGGCACACCATCCCAGGGGA GGG (reversed) Intronic
900833501 1:4982017-4982039 GGCCTCACAATCCCAGCGGAAGG + Intergenic
901035631 1:6334429-6334451 AGGCAGAGCAGCCCAGGGGAGGG + Intronic
902623379 1:17663159-17663181 GCGCTGATCATCCCAGGGGAGGG + Intronic
902672421 1:17983968-17983990 GGGCACAGCCTCCCTGGGTAAGG + Intergenic
902774243 1:18664432-18664454 GGGAACACCATGCCTGGGGAAGG + Intronic
903206465 1:21785990-21786012 TTGCACTCCATCCCAGGCGACGG + Intergenic
904975766 1:34455136-34455158 GGGGACTCCATCCCAGGAGATGG + Intergenic
907422329 1:54355847-54355869 GGGGACACGATCCCACGTGAGGG + Intronic
912752981 1:112300887-112300909 GCAAACACCATCCCAGGGCAGGG - Intergenic
912754377 1:112312339-112312361 GGGAACACTAGCCCTGGGGAGGG + Intergenic
913546160 1:119871213-119871235 GGTCACACCATTCCAGGGAGCGG + Intergenic
914196120 1:145448891-145448913 GGCCACCCCACCCCAGTGGAAGG + Intergenic
915076569 1:153312799-153312821 GGGCACTCCCTCCCTGGGAATGG + Intergenic
915080492 1:153348693-153348715 GGGCACTCCCTCCCTGGGAATGG + Intronic
919731619 1:200916571-200916593 GGGCACTCCATTCTTGGGGAAGG + Intergenic
919839835 1:201600894-201600916 GGGCAAACCTCCCCAGGAGATGG - Intergenic
920329869 1:205199168-205199190 GAGCACACCACCTCAGGGAATGG + Intronic
922796811 1:228343567-228343589 GGGGACACGAACCCAGGGGAAGG + Intronic
922892763 1:229074285-229074307 GGGCACCCCAGCCCACAGGAGGG + Intergenic
922899260 1:229123552-229123574 AGGCAAACCTGCCCAGGGGAGGG + Intergenic
924069119 1:240257240-240257262 GGGCACACGATCCCATGCGAAGG - Intronic
924176504 1:241396764-241396786 GGAAACCCCTTCCCAGGGGAAGG - Intergenic
924430132 1:243989593-243989615 GGGGACAGCATCTCAAGGGATGG - Intergenic
1065051172 10:21793289-21793311 GGGCGCTCCATCTCAGGGGTTGG + Intronic
1067294246 10:44965722-44965744 GGGCACACCATCCCAGGGGAGGG - Intronic
1069569878 10:69487881-69487903 GGGGACACCACCCAAGGGGAAGG - Intronic
1071416752 10:85448757-85448779 AGGCACCCCTTCCCAGGAGACGG + Intergenic
1073517208 10:104087063-104087085 GGGCACTGCATCCCATGGAAGGG + Intergenic
1074965322 10:118486273-118486295 GAGCTCACCATTCCAGGAGATGG + Intergenic
1076177694 10:128381075-128381097 GAGGACATCATCCCAGTGGAGGG - Intergenic
1076547769 10:131257284-131257306 GGACACCCCATCCCCTGGGAGGG + Intronic
1077279102 11:1733961-1733983 AGGCAAACCTTCCCAGGGAAGGG - Exonic
1077526413 11:3068225-3068247 GCTCAGACCCTCCCAGGGGATGG - Intergenic
1078359401 11:10656871-10656893 GGGCCCTGCCTCCCAGGGGAGGG + Intronic
1078919908 11:15820092-15820114 GGGCACAACATCTCTGGGGCTGG - Intergenic
1079348332 11:19672104-19672126 GGGAACAGCAAGCCAGGGGATGG + Intronic
1080606672 11:33869774-33869796 GCGCACACCATCCCCGCGGGCGG - Exonic
1081451134 11:43171900-43171922 GGGAACAATATCCCAGGGGGGGG - Intergenic
1081488018 11:43546975-43546997 GAGCACTGCATCCCAGGGGAGGG + Intergenic
1081989380 11:47329577-47329599 GGGCTCACCCTCTCAGAGGAAGG + Exonic
1083802419 11:65054169-65054191 GGGAACATCATCACAAGGGAAGG + Intronic
1083885869 11:65573285-65573307 GGGCCCACTATTCCAGGGGGCGG + Intronic
1085513723 11:77100507-77100529 GGGCACAAGACCCCTGGGGAGGG - Intronic
1086511554 11:87563552-87563574 GGCCTCACCATCACAGTGGAAGG - Intergenic
1090272465 11:125397784-125397806 GCCCCCACCACCCCAGGGGAGGG - Intronic
1090950072 11:131465285-131465307 GGGCCAACCATCCTAGAGGACGG - Intronic
1091079112 11:132649525-132649547 GGGGACACCCTCCCAGTGAAGGG + Intronic
1091770330 12:3147263-3147285 GGGCTCCTCATCCCAGGGCAGGG - Intronic
1091804237 12:3344294-3344316 GAGCACCCCATACCAGGGGAGGG + Intergenic
1092004755 12:5060037-5060059 TGGCACACCATTCCAGGGACTGG - Intergenic
1092854875 12:12664028-12664050 CTGCACACCAGCCCGGGGGACGG - Intronic
1095719688 12:45386897-45386919 GGGAAGGCCATCCCAGAGGAGGG - Intronic
1097285246 12:57872237-57872259 GGGATCCCCATCCCAGGGGATGG - Intergenic
1097805235 12:63957984-63958006 AGGCACAGCAGCCCTGGGGAAGG + Intronic
1099428410 12:82552702-82552724 GGCCACATGATCCCATGGGAAGG - Intergenic
1100575455 12:95887958-95887980 GGGTACACCAGCCCAGAGGAAGG - Intronic
1102341519 12:112125675-112125697 GGGTCCAGCATCCCAAGGGAGGG + Exonic
1104604226 12:130176156-130176178 GGGCCCCCGATCCCAGGAGAAGG + Intergenic
1104685347 12:130781097-130781119 GGGCTCACCCTCCCGGGGGAAGG + Intergenic
1109546281 13:63840691-63840713 GGGATCACCATCGCAGGGGCGGG + Intergenic
1117003717 14:51396940-51396962 AGGCACACCATGCGAGGGGCAGG + Intergenic
1118324981 14:64774575-64774597 GGGCACAACTTGCCAAGGGAGGG - Intronic
1119616513 14:76102351-76102373 GGACACAGCATCCCAGGTGGTGG + Intergenic
1119872607 14:78030043-78030065 GGACACCCCAGCCCTGGGGAGGG - Intergenic
1122308285 14:100779172-100779194 GGCCACACCCTCCCATGGCAGGG - Intergenic
1122563081 14:102631016-102631038 GGGCAAACATTCCCAGAGGAAGG + Intronic
1122932702 14:104942018-104942040 GGGGACAACATCCCAAAGGATGG + Exonic
1123030994 14:105450994-105451016 GGGCACACCTGCCAAGGGGCAGG + Intronic
1124106381 15:26741643-26741665 GGGCACTCCAGCCTGGGGGACGG - Intronic
1126098583 15:45106315-45106337 GGCCACTCCATCGCTGGGGAAGG + Exonic
1131517973 15:93091850-93091872 GGGCACCCAATCCAAAGGGATGG - Intergenic
1132682767 16:1150151-1150173 GGGCACGCCATCCGATGGGCTGG + Intergenic
1132725511 16:1336652-1336674 GAGCACACCATGCCAGTGGTGGG - Intronic
1132727168 16:1343914-1343936 GGGCTGACCATGCCCGGGGAAGG + Intronic
1133500641 16:6363283-6363305 TGGCATTCCATCCCAAGGGATGG + Intronic
1133774744 16:8887701-8887723 GGTCACACCAGCCCCGGGGAAGG + Intergenic
1134109914 16:11508775-11508797 GGAGACACCATCCCAGGCCATGG - Exonic
1135047857 16:19168965-19168987 TGGCACCCCACCCCAGGGGAGGG + Intronic
1137038945 16:35591959-35591981 GGGTCCACCATCCCAAGAGATGG - Intergenic
1139061998 16:63263833-63263855 GGGAGCCCCATCCCAGGGAAGGG + Intergenic
1139671371 16:68494022-68494044 GCTCCCAGCATCCCAGGGGATGG + Intergenic
1139938742 16:70590076-70590098 GGACAGACCCACCCAGGGGAGGG + Intronic
1141019495 16:80481868-80481890 GGAGACACAATTCCAGGGGAAGG - Intergenic
1142262516 16:89049602-89049624 GGGCACATCAGCCCTGGGGCTGG - Intergenic
1142285703 16:89170702-89170724 ACCCACACCATCCCAGGGGGCGG + Intergenic
1142286415 16:89173270-89173292 TGGCACCCCAACCCAGGGCATGG + Intronic
1143130433 17:4673937-4673959 TGCCACCCCATCCCATGGGAAGG - Intronic
1143708791 17:8718965-8718987 GCCCACACCATCCTTGGGGACGG - Intergenic
1144726971 17:17506941-17506963 GGTCACCCCAGCCCAGAGGACGG + Intronic
1144945239 17:18966346-18966368 GGGAACAGCATCCCCGAGGAAGG - Intronic
1144958721 17:19032918-19032940 GCCCACACCATCCCGGGGGTGGG + Intronic
1144976438 17:19141606-19141628 GCCCACACCATCCCGGGGGTGGG - Intronic
1146159254 17:30551057-30551079 GGCCACATCCTCCCAGGGTAAGG - Intergenic
1146868418 17:36358941-36358963 CTGCACACCAGCCCAGGTGACGG + Intronic
1147071290 17:37959565-37959587 CTGCACACCAGCCCAGGTGACGG + Intergenic
1147082817 17:38039091-38039113 CTGCACACCAGCCCAGGTGACGG + Intronic
1147098761 17:38163062-38163084 CTGCACACCAGCCCAGGTGACGG + Intergenic
1147169019 17:38607338-38607360 GGGCACACGACCCCAGCGGCAGG + Intergenic
1148782184 17:50128694-50128716 GGGCGCACAATTCCTGGGGAGGG + Intronic
1151326019 17:73380183-73380205 GGGTAGACCTACCCAGGGGAAGG - Intronic
1151548354 17:74807050-74807072 GGGCAGACCATGCCACGTGAGGG - Intronic
1151786250 17:76276461-76276483 GGCCACCCCATCCCAGCTGATGG + Intronic
1152223608 17:79082520-79082542 GGTCACACCAGCACAGAGGAAGG + Intronic
1152656244 17:81520310-81520332 GGTCACACCATGCCCAGGGAAGG + Intronic
1155157949 18:23173225-23173247 GGGCAAACCCTCCCAGAGCAGGG - Intronic
1156497949 18:37538147-37538169 GGCCTCCTCATCCCAGGGGATGG + Intronic
1161017468 19:1990498-1990520 GAGCCCACCATCCCAGCTGATGG - Intronic
1161075540 19:2283411-2283433 CGGCACTCCAGCCTAGGGGACGG - Intronic
1161242139 19:3228468-3228490 GTGCCCACCCTGCCAGGGGAAGG + Intronic
1161295190 19:3516190-3516212 GGCCTCACCATCCCAGGCGTGGG - Intronic
1161338874 19:3729946-3729968 GGGCACCCCCTCCCCAGGGAGGG + Intronic
1161503790 19:4633109-4633131 GGGAACAGCATCCCAGGCTATGG + Intergenic
1161715438 19:5873702-5873724 GGGCACAGAATCCCCGGAGAAGG - Intronic
1162031384 19:7918907-7918929 GGGCGCACCATCCCTGGGAGGGG - Exonic
1162514343 19:11139026-11139048 GAGCAGCCCAGCCCAGGGGAGGG - Intronic
1164676818 19:30106706-30106728 GGGGACATCATCCCAGTTGATGG + Intergenic
1165721257 19:38081582-38081604 GTCCACACCATCGCTGGGGATGG - Exonic
1165768006 19:38362645-38362667 GGGGACACCATCGGAGGGGCGGG + Intronic
1166782295 19:45348969-45348991 GTGCTCAGCATCCCTGGGGAGGG - Intronic
1167463816 19:49639915-49639937 GGGGACACCCTCCCGGGTGAGGG + Intronic
1168290988 19:55357482-55357504 GGGGAAAGCATCCCAGCGGAAGG - Intronic
926500666 2:13649122-13649144 GGGGAATACATCCCAGGGGAGGG + Intergenic
926694745 2:15763393-15763415 GAGCACTGCATCCCAGGGGAAGG + Intergenic
926767840 2:16337977-16337999 GAGCACACCATCCAGGGGGGTGG + Intergenic
926790745 2:16569085-16569107 GCGCTCTCCATCCCAGGTGAAGG + Intronic
927643551 2:24860784-24860806 AGGTACAACTTCCCAGGGGATGG + Intronic
928270595 2:29851414-29851436 CAGAACACCATCCCAGAGGAAGG - Intronic
928582438 2:32722820-32722842 GGGCACACAATCTCAGGACATGG + Intronic
933225266 2:79741068-79741090 GGGCACGGCAACTCAGGGGAAGG + Intronic
934553818 2:95277205-95277227 GGGCACATTAAGCCAGGGGAGGG - Intronic
934858099 2:97741429-97741451 GGGGACATCACCCCGGGGGACGG - Intergenic
935644006 2:105318011-105318033 GGCTCCACCATGCCAGGGGAAGG + Intronic
936871950 2:117144082-117144104 CGGCACTCCAGCCCAGGAGACGG + Intergenic
937840597 2:126520462-126520484 GGGCACTCCTTCCCAGGACAGGG - Intergenic
938067136 2:128287318-128287340 GGGCAGTGCATCTCAGGGGAAGG - Intronic
944464195 2:199983889-199983911 GAGCAAACCTTCCCAGGGAATGG - Intronic
944579459 2:201118930-201118952 GGCGACACCAGCCCAGGGGCGGG - Intronic
944878090 2:203983385-203983407 AGCCACAGCATCCCAGGGCAGGG - Intergenic
947064551 2:226207883-226207905 TGACAGACCATCCCAGGGGAGGG + Intergenic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
947944095 2:234084790-234084812 GGGGAAACCATGCCAGGGTAGGG + Intergenic
1168998156 20:2147711-2147733 GGGAAAACCAGCCAAGGGGAGGG - Exonic
1171240451 20:23563325-23563347 GAGCACAGGATCACAGGGGATGG + Intergenic
1172414142 20:34750328-34750350 GGGCCCACCATCTCAGCTGATGG - Exonic
1172442855 20:34978075-34978097 GTGCACACTATCCCATGGGACGG + Exonic
1173202025 20:40961338-40961360 GGGCTCAACACCCCAGGGCAGGG + Intergenic
1175227135 20:57451230-57451252 GGGCACACAAGCCCAGGGCTGGG + Intergenic
1175531275 20:59675278-59675300 TATCACACCATCCCTGGGGAAGG + Intronic
1176201251 20:63861635-63861657 GCGCACGTCATCCCAGCGGAAGG - Exonic
1179175072 21:39002273-39002295 GGGGCCACCAGCCCAGGGGCAGG + Intergenic
1180211464 21:46297493-46297515 GCGGACACCTTCCCTGGGGAGGG + Intronic
1180785743 22:18546700-18546722 GGGCAGAGCATTCCAGGGAAGGG - Intergenic
1180832001 22:18911243-18911265 GGGCACAGCAGGCCTGGGGAGGG - Intronic
1180981719 22:19881252-19881274 TGGCAGCCCATCCCAGAGGACGG - Intronic
1181131023 22:20732425-20732447 GGGCAAAGCATTCCAGGGAAGGG - Intronic
1181242668 22:21486254-21486276 GGGCAAAGCATTCCAGGGAAGGG - Intergenic
1182371913 22:29817214-29817236 GGGCACACCTTCACAGGTTATGG - Intronic
1182511862 22:30825704-30825726 GAGCCCACCATGCCAGGGCATGG - Intronic
1183623396 22:38987453-38987475 GGGAGCACCCTCCCAGGGCAGGG - Intronic
1183632137 22:39040144-39040166 GGGAACACGCTACCAGGGGAAGG + Intergenic
1183633636 22:39047779-39047801 GGGAGCACCATCCCAGGGCGGGG - Intronic
1183637957 22:39076545-39076567 GGGAACACGCTACCAGGGGAAGG + Intronic
1184286995 22:43477469-43477491 GGACCCAGCCTCCCAGGGGAGGG - Intronic
1184478003 22:44731824-44731846 GGGCAGCCCAGCCCTGGGGAGGG + Intronic
1185373280 22:50470587-50470609 GGGCAGAGTTTCCCAGGGGAGGG - Intronic
1203282079 22_KI270734v1_random:136514-136536 GGGCACAGCAGGCCTGGGGAGGG - Intergenic
953994916 3:47512512-47512534 GTGCACTCCAGCCCAGGCGAGGG + Intronic
954853763 3:53625512-53625534 GAGCACATCTTCCTAGGGGAGGG - Intronic
955054642 3:55444696-55444718 GGGCACCCTATTCCAGGGGAGGG - Intergenic
956445899 3:69325350-69325372 GGGCAGACATTCCCTGGGGAGGG + Intronic
956699999 3:71950537-71950559 GGCCACAGCAGCCCAGAGGAAGG + Intergenic
958468095 3:94483268-94483290 GGGCACACTGACCCAGGGCAGGG + Intergenic
961000488 3:123370896-123370918 GGGCACACAAAGCCAAGGGAAGG + Intronic
962256121 3:133871391-133871413 GGGAACAACATTCCCGGGGAAGG + Intronic
967074643 3:185991040-185991062 GGGGATACCAGCCCAGGGGCAGG - Intergenic
968973346 4:3808159-3808181 GGGCTCACCACCCCCTGGGATGG + Intergenic
969292971 4:6252433-6252455 GGCCATACCATCCCAGAGCATGG + Intergenic
969521521 4:7680532-7680554 GGGCAGACAGTCCCAGGGGCCGG - Intronic
971687577 4:29788442-29788464 GGGCTCACAATCACAGAGGAAGG + Intergenic
976223688 4:82778559-82778581 GGCCAGACCATCCCCAGGGAGGG + Intronic
978026134 4:103877133-103877155 GGGCACACCATTCATGGAGATGG - Intergenic
978613658 4:110571850-110571872 GAGCACACCATCCAAGGGCCTGG + Intergenic
981716543 4:147757840-147757862 GGGCACCAGATCCCAGGGAAGGG - Intronic
982559119 4:156907732-156907754 GGCCACTTCATCCCAGGTGAAGG - Intronic
986350076 5:6868986-6869008 AGGCTCAGCATCACAGGGGAGGG + Intergenic
986757986 5:10855676-10855698 GGGGACACCAGCCCAGGAAAGGG - Intergenic
988077091 5:26367157-26367179 GAGCACACCATCCAAGGGCTTGG - Intergenic
990213290 5:53503912-53503934 GGGCTCACCCTTCCAGGGCATGG - Intergenic
992269464 5:75051122-75051144 GCACACACCATTCCCGGGGATGG + Intergenic
995007153 5:107213365-107213387 GGGGTCAACATCCCAGGGCAGGG + Intergenic
999237903 5:150110311-150110333 GAGCACACCTTGACAGGGGAGGG - Intronic
1000343043 5:160292139-160292161 GCACACACCATCCTAGGGCAAGG + Intronic
1002471648 5:179439211-179439233 GGGCCCAGGATCCCAGGGCAGGG + Intergenic
1007417878 6:41702638-41702660 GGCCTCACCTTCCCTGGGGAGGG - Intronic
1009803593 6:68573555-68573577 GGGCAGAGCATCCCTGGGCAGGG + Intergenic
1013589214 6:111606116-111606138 GGAGACACCCTCCCAGGCGAGGG - Exonic
1018618746 6:165710967-165710989 GGGCAGACCATCCCCGTGGGAGG + Intronic
1019151706 6:170010853-170010875 GGGCACCCCATCCCTGGTGCTGG - Intergenic
1019203911 6:170342972-170342994 AGGCAGACCAACTCAGGGGAGGG - Intronic
1019411140 7:907287-907309 TGGCAGACGATCACAGGGGAGGG + Intronic
1021489591 7:21204194-21204216 GAGCGCACCATGCCATGGGATGG + Intergenic
1022045722 7:26620692-26620714 GGGCACACCTGCAGAGGGGAGGG + Intergenic
1023043914 7:36195306-36195328 GGGCAGAGCAGCCCAGTGGATGG + Intronic
1024686440 7:51750938-51750960 GGGAAGACCATCCCAGGGAGAGG - Intergenic
1025113084 7:56235741-56235763 TAGCACCCCATCCCAGGGTAGGG - Intergenic
1028872114 7:95781522-95781544 GGGCAGACTATACCAGGGAAAGG - Intronic
1029482166 7:100819818-100819840 GGGCACTCCATTCCAGGTGCAGG + Exonic
1032903939 7:136342845-136342867 GAGGACAGCATCCCAGGAGATGG + Intergenic
1033732856 7:144195714-144195736 GGACACACCTTCCCGGAGGAGGG + Intergenic
1033743706 7:144294294-144294316 GGACACACCTTCCCGGAGGAGGG + Intergenic
1033750195 7:144355303-144355325 GGACACACCTTCCCGGAGGAGGG - Intronic
1035140901 7:156759798-156759820 GAGCACACCTGCACAGGGGAGGG + Intronic
1035360844 7:158313421-158313443 GGACACACAGTCCCTGGGGATGG + Intronic
1036469265 8:9036762-9036784 TGGCACACCATCACTGGTGATGG + Intronic
1038340497 8:26681491-26681513 GCACACACCATCCCTGGGCATGG - Intergenic
1039843002 8:41307051-41307073 GGGCACAGCCTCACAGGGCAGGG + Intronic
1042325959 8:67528221-67528243 TGGGACACCTTCCCAGGAGAGGG + Intronic
1043358648 8:79443065-79443087 GGGCACACCATACCAGAGACAGG + Intergenic
1049003656 8:139841563-139841585 GGCCAATCCATCCCAGGGCAAGG + Intronic
1049467074 8:142756461-142756483 GGCCACCTCATCCCAGGGGAGGG + Intergenic
1049613759 8:143567584-143567606 GGCCCCACCTTGCCAGGGGATGG - Intronic
1053738043 9:41113933-41113955 GGGAACAACATCCCTGGGGGGGG + Intergenic
1054690305 9:68317387-68317409 GGGAACAACATCCCTGGGGGGGG - Intergenic
1057583512 9:96308799-96308821 GTACACAGCTTCCCAGGGGAAGG + Intergenic
1062393129 9:136341949-136341971 TGGCACAAAAACCCAGGGGATGG - Intronic
1062698612 9:137887944-137887966 GGCCACCCCACCCCAGTGGAAGG - Intronic
1203488828 Un_GL000224v1:84435-84457 GGGTACTGCATCCCATGGGAGGG - Intergenic
1203501449 Un_KI270741v1:26330-26352 GGGTACTGCATCCCATGGGAGGG - Intergenic
1186559021 X:10590468-10590490 GGTCGCAGCATTCCAGGGGAGGG + Intronic
1187249530 X:17584291-17584313 GGCCACCCCTTCCCTGGGGAGGG + Intronic
1189251236 X:39601900-39601922 GGCCACACCAGCCCAGCGCAGGG + Intergenic
1190877894 X:54472597-54472619 GGGCATGCCATCCCTGGGGTGGG - Intronic
1195863996 X:109409811-109409833 GGGCTCACAATCATAGGGGAGGG - Intronic
1198224767 X:134635077-134635099 GGTCAGACTATCCCAGGGAAAGG - Intronic