ID: 1067296311

View in Genome Browser
Species Human (GRCh38)
Location 10:44976989-44977011
Sequence AACTGGTGGTAGGGGTGTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 428}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067296311_1067296323 14 Left 1067296311 10:44976989-44977011 CCCTCACACCCCTACCACCAGTT 0: 1
1: 0
2: 2
3: 44
4: 428
Right 1067296323 10:44977026-44977048 GATGGTAGCTACTCAGCCAGTGG 0: 1
1: 0
2: 0
3: 6
4: 104
1067296311_1067296325 28 Left 1067296311 10:44976989-44977011 CCCTCACACCCCTACCACCAGTT 0: 1
1: 0
2: 2
3: 44
4: 428
Right 1067296325 10:44977040-44977062 AGCCAGTGGGCTCCTATATGCGG 0: 1
1: 0
2: 0
3: 58
4: 601
1067296311_1067296318 -4 Left 1067296311 10:44976989-44977011 CCCTCACACCCCTACCACCAGTT 0: 1
1: 0
2: 2
3: 44
4: 428
Right 1067296318 10:44977008-44977030 AGTTTCCCCACCAGCGATGATGG 0: 1
1: 0
2: 0
3: 12
4: 128
1067296311_1067296324 15 Left 1067296311 10:44976989-44977011 CCCTCACACCCCTACCACCAGTT 0: 1
1: 0
2: 2
3: 44
4: 428
Right 1067296324 10:44977027-44977049 ATGGTAGCTACTCAGCCAGTGGG 0: 1
1: 0
2: 1
3: 2
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067296311 Original CRISPR AACTGGTGGTAGGGGTGTGA GGG (reversed) Exonic
900586119 1:3433117-3433139 AACAGGGGGAAGGGGTGGGAAGG + Intronic
900990952 1:6098064-6098086 AACTGGATGTGGGGGTGAGAAGG + Intronic
904306159 1:29591782-29591804 TGCTGGGGGTGGGGGTGTGATGG + Intergenic
904594300 1:31633313-31633335 ACCTGGAGGAAGGGGTGTGAAGG + Exonic
905304676 1:37009396-37009418 ATCTGGGGCTGGGGGTGTGAGGG - Intronic
906434204 1:45781170-45781192 AACTGGTGGCAGGGCAGAGAGGG + Intergenic
906592707 1:47042598-47042620 AAATGGTGGGAGGGAGGTGAGGG - Intronic
906784149 1:48599564-48599586 AGGTGGTGGTAGAGGTGAGAAGG + Intronic
906912713 1:49972306-49972328 AAAGGGTGGGAGGGGTGTGAGGG - Intronic
907095930 1:51780806-51780828 GAAGGGTGGGAGGGGTGTGAAGG + Intronic
907373758 1:54019277-54019299 AAATGCTGGTCGGGGGGTGAGGG + Intergenic
907554618 1:55333625-55333647 GACTGGTGGCAGGGTTGTGGGGG + Intergenic
907719598 1:56959409-56959431 AACTGGAGGTAGGGCTGAGGAGG + Intronic
908676553 1:66610985-66611007 AAAGGGTGGGAGGGGGGTGAGGG + Intronic
909195419 1:72615472-72615494 AACTGGGGGTTGAGGGGTGATGG + Intergenic
909790685 1:79674287-79674309 AAAGGGTGGGAGGGGGGTGAGGG - Intergenic
910022441 1:82608501-82608523 GAATGGTGGGAGGGGGGTGAGGG + Intergenic
910157865 1:84240706-84240728 AAAGGGTGGGAGGGGTGTGAGGG - Intergenic
911533667 1:99075832-99075854 CACTGGTGGTATGGGTATGATGG - Intergenic
911651961 1:100398943-100398965 TTCTGGTGGTAGGGGAGTGAAGG + Intronic
911666060 1:100554010-100554032 AAAGGGTGGGAGGGGGGTGAGGG - Intergenic
911743750 1:101416598-101416620 AAAGGGTGGTACGGGGGTGAGGG + Intergenic
911873662 1:103131856-103131878 AAAGGGTGGGAAGGGTGTGAGGG - Intergenic
912457207 1:109806186-109806208 CTTTGGGGGTAGGGGTGTGAGGG - Intergenic
913403069 1:118457319-118457341 AAAGGGTGGGAGGGGGGTGAGGG + Intergenic
914681059 1:149938622-149938644 ATCGGGGGGTAGGGGTGTGGTGG + Exonic
915206352 1:154273099-154273121 AACTGGGGGAAGGTGTATGAAGG + Intronic
915486572 1:156225439-156225461 AAAGGGTGGGAGGGGGGTGAGGG - Intronic
915734968 1:158078726-158078748 AACTGGGGTGAGGGGTGGGAGGG + Intronic
916184201 1:162114859-162114881 AAGTTGTTGTAGGGGTGGGATGG + Intronic
917337194 1:173937178-173937200 AATGGGTGGTGGGGGTGGGAAGG - Exonic
917918365 1:179727432-179727454 AACTGTAGGTAGGGGTGGTAAGG + Intergenic
919307413 1:195859765-195859787 AAAGGGTGGGAGGGGGGTGAGGG + Intergenic
919407587 1:197203936-197203958 AAAGGGTGGGAGGGGGGTGAGGG - Intergenic
920164417 1:204025614-204025636 AACTGGTGGGAGCCGGGTGATGG - Intergenic
920350724 1:205336348-205336370 AACTGGTGGTGGCTGTGAGAAGG + Exonic
920800740 1:209185053-209185075 AAAGGGTGGAAGGGGGGTGAGGG + Intergenic
921256362 1:213343646-213343668 AAAGGGTGGGAGGGGGGTGAGGG + Intergenic
922410185 1:225365788-225365810 TACTGGGGGTAGGGGAATGAAGG + Intronic
922742270 1:228020650-228020672 AAATGGTGGAGGGGGTGTGCAGG + Intronic
922969731 1:229726239-229726261 AGGTGGTGGTAGGGTGGTGATGG - Intergenic
923134569 1:231106847-231106869 GATTGATGATAGGGGTGTGAGGG + Intergenic
924277111 1:242400251-242400273 AACTGGGGGTGGGGGTGGGTGGG - Intronic
1064625983 10:17261755-17261777 AACTGGTGGTAGGGATGGTGGGG + Intergenic
1064944549 10:20773157-20773179 AAAGGGTGGGAGGGGTGTGACGG - Intergenic
1065495445 10:26322650-26322672 AAATGGTGGGAAGGGTGTAAGGG - Intergenic
1066569527 10:36755793-36755815 AACTGGAGTTTGGGGTTTGAGGG - Intergenic
1067296311 10:44976989-44977011 AACTGGTGGTAGGGGTGTGAGGG - Exonic
1068122314 10:52795370-52795392 AAATGGTGGGAGGGGGGTGAGGG - Intergenic
1069577206 10:69539250-69539272 AAAGGGTGGGAGGGGAGTGAGGG + Intergenic
1069943139 10:71969079-71969101 AACACGTGGCAGGGGTGGGAAGG - Intronic
1070271016 10:74955024-74955046 CAGTGGTGGTAGAGGGGTGAGGG - Intronic
1071023693 10:81087280-81087302 AAATGGTGGGAAGGGAGTGAGGG - Intergenic
1071287139 10:84159316-84159338 AACTGCAGGTAGGGCTGAGATGG - Intergenic
1071496506 10:86170977-86170999 AACGGGTGGTGGCGGTCTGAAGG - Intronic
1071561967 10:86652012-86652034 ACCTGGTCGGAGGGGAGTGATGG + Intergenic
1071663784 10:87533119-87533141 AACAAGGGGTAGGGGTGGGATGG - Intronic
1074300233 10:112226657-112226679 AACAGGTGGTGAGGTTGTGAGGG + Intergenic
1075393153 10:122107818-122107840 AAAGGGTGGGAGGGGGGTGAGGG - Intronic
1075533897 10:123254530-123254552 CAGTGGTGGTGGTGGTGTGATGG - Intergenic
1075533940 10:123254790-123254812 CAGTGGTGGTGGTGGTGTGATGG - Intergenic
1075533962 10:123254904-123254926 TAGTGGTGGTGGTGGTGTGATGG - Intergenic
1075560698 10:123466462-123466484 AATTGGGGGTCGGGGTGTGATGG - Intergenic
1075974805 10:126685915-126685937 CACTGGGGGATGGGGTGTGATGG + Intergenic
1077316296 11:1920828-1920850 GGCTGGTGGCAGGGGTGTGCTGG - Intronic
1078093567 11:8282899-8282921 AGCTGGTGGTGGCGGTGTGACGG - Intergenic
1078777167 11:14404164-14404186 AACTAGTAGCAGGGGTGAGAAGG - Intergenic
1079547135 11:21646135-21646157 AGCTGGTGGTAAGGATGTGTTGG + Intergenic
1081994480 11:47354900-47354922 AATGGGTGGGAGGGGTGAGAGGG + Exonic
1082850847 11:57763400-57763422 AATTTGTGGCAGGGGGGTGAGGG - Intronic
1082868912 11:57925487-57925509 AACAGGTGGAAGGAGGGTGAGGG - Intergenic
1083261120 11:61523699-61523721 GACTGGAGGTCGGGGTGTGGCGG + Intronic
1085861619 11:80242661-80242683 ACCTGGTGGTAGGGCTTTGGGGG + Intergenic
1086447935 11:86887697-86887719 TACTGGGAGTAGGGGTGGGAGGG + Intronic
1086811473 11:91315877-91315899 AAATGGTGGGAAGGGAGTGAGGG - Intergenic
1086817487 11:91391327-91391349 AAAAGGTGGGAGGTGTGTGAGGG + Intergenic
1086932235 11:92705605-92705627 ATGTGGTGGTGGTGGTGTGATGG + Intronic
1089203469 11:116739754-116739776 AACTAGTGGTGGGGGTGGGGAGG - Intergenic
1090552855 11:127841791-127841813 AACGGGTGGGAGGGGAGTGAGGG - Intergenic
1090631888 11:128656809-128656831 ACCTGGTGGTTGTGGTTTGAGGG - Intergenic
1091078777 11:132646078-132646100 AAAGGGTGGGAGGGGGGTGAGGG + Intronic
1092081110 12:5717228-5717250 AACTGGTAGGAGGTGTGGGAAGG - Intronic
1092929478 12:13301752-13301774 AAAGGGTGGGAGGGGTATGAGGG + Intergenic
1093347170 12:18052065-18052087 AAAGGGTGGTAGGCGGGTGAGGG + Intergenic
1094360054 12:29620916-29620938 CACTGGTGGTCGGGGTCAGAAGG + Intronic
1094591262 12:31823201-31823223 AAAAGGTGGGAGGGGAGTGAGGG - Intergenic
1095531496 12:43191734-43191756 AAATGGGGGTAGGGATGTGTAGG - Intergenic
1097093030 12:56522498-56522520 TACTGGTGGTATGGGTAGGAGGG - Intronic
1097214321 12:57398102-57398124 AACTGGTGGTGGGGGTGGGCAGG + Intronic
1097343594 12:58467005-58467027 AACTGCTTGTAGGGGTCTGGAGG + Intergenic
1098763605 12:74456559-74456581 AAGTGGGGGTGGGGGTGTGGGGG - Intergenic
1099310543 12:81015892-81015914 AACTGTCGGCAGGGGTGTGCTGG - Intronic
1099391927 12:82092122-82092144 AAAGGGTGGGAGGGGGGTGAGGG - Intergenic
1099936955 12:89137709-89137731 AAAAGGTGGGAGGGGGGTGAGGG + Intergenic
1100000350 12:89827197-89827219 AAAGGGTGGAAGGGGGGTGAGGG + Intergenic
1101063319 12:100994123-100994145 CCCTGGTGGTAGTGGTGGGATGG + Intronic
1103425740 12:120831819-120831841 CTTTGGTGGTAGTGGTGTGAGGG - Intronic
1103546958 12:121709057-121709079 AACAGGTGATAGGGAAGTGATGG + Intergenic
1104414101 12:128583748-128583770 AACTTGTGGTTGGGGTGGGGCGG - Intronic
1104444553 12:128823216-128823238 GACTGGAGGTACCGGTGTGATGG - Intronic
1105589958 13:21783228-21783250 AGCTGGGGGTAAGGGAGTGAGGG + Intergenic
1106307992 13:28530693-28530715 ATATGGTGGTAGGGGTGTCCAGG + Intergenic
1106543710 13:30713115-30713137 AACTGGTGGTGGAGGAGGGAAGG + Intergenic
1106685984 13:32059678-32059700 AAAAGGTGGGAGGGGTGTGAGGG - Intronic
1107237333 13:38187706-38187728 CAATGGTGGTTGGGGTCTGAAGG - Intergenic
1107606562 13:42063322-42063344 AGCTGGTGGGAAGGGAGTGAGGG + Intronic
1107839878 13:44446348-44446370 AACTTGGGGTAGGGGAGGGAGGG + Intronic
1108127860 13:47264113-47264135 GACTTCTGGTAGGGGTGGGAGGG - Intergenic
1108189644 13:47924382-47924404 AATGGGTGGGAGGGGAGTGAGGG + Intergenic
1108494096 13:51007383-51007405 AATTGGTGGCAGGGTTGGGAGGG - Intergenic
1108902405 13:55428028-55428050 AAAGGGTGGGAGGGGGGTGAGGG + Intergenic
1109142025 13:58725306-58725328 AGCTGGTGGCAGGAGTGTGGAGG + Intergenic
1109219532 13:59627298-59627320 ATTTGGTGGTAGGGGTGGGGTGG + Intergenic
1109742498 13:66573073-66573095 AAATGCTGGTAAGGATGTGAAGG - Intronic
1109912714 13:68936500-68936522 AAATGGTGGAAGGGCTGTGGGGG + Intergenic
1110182845 13:72637754-72637776 AACTGGTGGGAGGTGGGTGATGG + Intergenic
1111992580 13:95131799-95131821 AAGTGTTGGCAGGGATGTGAAGG + Intronic
1112216516 13:97435490-97435512 AACTGGTGGTGGTGGTGTGGTGG - Intronic
1112273639 13:97995310-97995332 AAAGGGTGGGAGGGGAGTGAGGG - Intronic
1112300657 13:98226837-98226859 AAATGGTGGTGGGAGAGTGATGG - Intronic
1112865586 13:103892629-103892651 ACCTGGGGGCGGGGGTGTGACGG - Intergenic
1113338523 13:109399849-109399871 GACTGGAGGTAGGGGAGTGAGGG + Intergenic
1114306810 14:21431002-21431024 ACCTGGTCGAAGGGGTGTGCCGG + Exonic
1114559732 14:23580999-23581021 GAGTGGGGGTAGGGGGGTGAGGG - Intergenic
1117156595 14:52948118-52948140 AGATGGTGGTAGGGATGAGATGG - Intronic
1117298622 14:54401767-54401789 AACAGGTGGAAGGGGGATGAAGG - Intronic
1117691765 14:58314714-58314736 AATGGGGGGCAGGGGTGTGATGG - Intronic
1117697284 14:58378478-58378500 AACGGGTGGGAGGGGGATGAAGG - Intergenic
1117783414 14:59257977-59257999 CAATGGTGGTAGTGGTGGGAGGG - Intronic
1117823715 14:59678200-59678222 CAGTGGTGGTAGGGGTGCGTGGG + Intronic
1118239876 14:64045894-64045916 AACTGGGTGCAGGGGTGTGAAGG - Intronic
1119511567 14:75215578-75215600 ACCTGGTGGTGGTGGTGGGAGGG + Intergenic
1120325312 14:83016803-83016825 AAATGTTGGGAGGGGTGTGAGGG + Intergenic
1121358692 14:93235414-93235436 AACTGGTCCCAGGGGTGGGAAGG - Intergenic
1121475883 14:94202154-94202176 AAAGGGTGTGAGGGGTGTGAGGG + Intronic
1121908588 14:97769203-97769225 AACGGGTGGAAAGGGGGTGAGGG - Intergenic
1122051574 14:99064559-99064581 AAGTGGTGGGATGGGTATGAAGG + Intergenic
1122819325 14:104333328-104333350 TGCTGGAGGTAGGGGTGTGGAGG - Intergenic
1122977854 14:105178351-105178373 AACTGGGGGTAGGGGTGTGTGGG - Intronic
1126502573 15:49362306-49362328 ACGTGGTGGTAGGAGAGTGAAGG - Intronic
1126918131 15:53488877-53488899 AATGGGGGGTAGGGGAGTGATGG + Intergenic
1127389761 15:58496071-58496093 AACTCGTGATAGGGATGAGAAGG - Intronic
1127698530 15:61474722-61474744 AGAGGGTGGTAGGGGTGTGAGGG + Intergenic
1128292561 15:66489131-66489153 GGCTGGTGGGAGGGGTGGGATGG + Intronic
1129123978 15:73422095-73422117 AAGTGGTGGTGGAGGTGAGAAGG + Intergenic
1129536824 15:76320070-76320092 ATGGGGTGATAGGGGTGTGATGG - Intergenic
1130194908 15:81770642-81770664 AACTGGGGCTAGGGATGAGAGGG + Intergenic
1130933728 15:88451009-88451031 GACTGGTGGTAGGGGGGACAGGG + Intergenic
1131279583 15:91009702-91009724 AGCTGGTGGTGGGGGTGGGGTGG + Intronic
1132279934 15:100603419-100603441 AACTGGGGGTGGGGGTGGGGGGG - Intronic
1133474031 16:6102566-6102588 AGCTGCTGGAAGGGGTGGGAGGG - Intronic
1133685898 16:8165383-8165405 AAAGGGTGGGAGGGGGGTGAGGG - Intergenic
1133722950 16:8512004-8512026 AAAAGGTGGTAGGTGTGTTATGG - Intergenic
1133923970 16:10179875-10179897 AAGTGGGGGTGGGGGTGGGAGGG - Intronic
1134118983 16:11570494-11570516 CACTGCGGGTAGGGGTGGGAAGG - Intronic
1135199580 16:20425569-20425591 AAATGGTGGGAAGGGGGTGAGGG - Intronic
1135560215 16:23470380-23470402 AACTGGTGGTGTGTGTATGATGG - Intronic
1135573503 16:23567268-23567290 AACTGATGGAAGGTGTGTGTGGG - Intronic
1136930031 16:34410354-34410376 GAATGGTGGGAGGGGTGAGAGGG + Intergenic
1136974543 16:35001451-35001473 GAATGGTGGGAGGGGTGAGAGGG - Intergenic
1137577188 16:49608043-49608065 AACTGGTGCTTGGGGGTTGAGGG - Intronic
1138753750 16:59456891-59456913 AAAGGGTGGGAGGAGTGTGAGGG - Intergenic
1139286025 16:65815148-65815170 AAAGGGTGGTAGGGGGGTGAGGG - Intergenic
1139304460 16:65972005-65972027 AAAGGGTGAGAGGGGTGTGAGGG + Intergenic
1140525765 16:75621679-75621701 ACCTGGTGGTGGGGGTGAAAGGG + Intronic
1140663621 16:77210541-77210563 AAATGGTGGTAGTGATGGGAGGG - Intronic
1141168546 16:81676802-81676824 AGCTGGGGGAAGGGGTGGGAGGG - Intronic
1142552662 17:750742-750764 AAATGGTGGGAGGGGTAAGATGG - Intronic
1142940229 17:3374849-3374871 AAAGGGTGGGAGGGGAGTGAGGG - Intergenic
1143984115 17:10896372-10896394 TAGTGCTGGTAGGGGAGTGAAGG + Intergenic
1146506406 17:33409575-33409597 AATTGGTGGTGGAGGGGTGAGGG - Intronic
1147301660 17:39533713-39533735 AAATGGGGGTGGGGGTGAGATGG - Exonic
1147745979 17:42694861-42694883 TACTGGTGGGAGGAGTGTGGGGG + Intronic
1148725003 17:49782798-49782820 AAATGGTGGAAGGGGGTTGAGGG + Intronic
1148907116 17:50918777-50918799 AGCTGGTGGTGGGGGTGAGCTGG + Intergenic
1149015499 17:51904360-51904382 AAATGGTGGGAGAGGGGTGAGGG - Intronic
1149399762 17:56283740-56283762 AAAGGGTGGGAGGGGGGTGAGGG + Intronic
1149916728 17:60616133-60616155 AACTGGGGTTATGGGTGTGGTGG + Intronic
1150902746 17:69299699-69299721 AAAAGGTGGGAGGGGGGTGAGGG + Intronic
1150944034 17:69724846-69724868 AAGTGGTGGCAGGGTTGGGATGG - Intergenic
1151062152 17:71107765-71107787 GAATGGGGGTAGGGGTGAGAAGG + Intergenic
1154238800 18:12632348-12632370 ATTTGGTGGTGGTGGTGTGAGGG - Intronic
1155314615 18:24558993-24559015 AAATGGTGGGGGGGGTGGGAGGG - Intergenic
1155320291 18:24612295-24612317 GACTGGTGGTAGGGGGTGGAAGG + Intergenic
1156052150 18:32950628-32950650 AACTGGTGATATGGCTGTGTGGG + Intronic
1156892934 18:42210746-42210768 GAGTGGTGGTGGGGGCGTGAGGG - Intergenic
1157613680 18:48975039-48975061 AGCTGGTGGCAGGGCTGTGACGG + Intergenic
1157702385 18:49770389-49770411 AAAAGGTGGGAGGGGGGTGAGGG - Intergenic
1157810085 18:50688737-50688759 AAAGGGTGGGAGGGGGGTGAGGG + Intronic
1159200249 18:65174366-65174388 AAATGGTGGGAAGGGGGTGAGGG + Intergenic
1161299490 19:3535992-3536014 AAGGGGTGGTGGGGGGGTGAGGG - Intronic
1163270237 19:16248642-16248664 AACTGGTGGGAAGTGGGTGAGGG - Intergenic
1164746293 19:30617271-30617293 AAAGGGTGGGAGGGGAGTGAGGG - Intronic
1166428619 19:42702332-42702354 AAATGGTGGGAAGGGGGTGAGGG - Intronic
1167001867 19:46750280-46750302 ACCTGCTGGTGAGGGTGTGAGGG - Intronic
1167596196 19:50429377-50429399 ACTTGGTGGTGGAGGTGTGAGGG + Exonic
1167684812 19:50949772-50949794 AAGTGGGGGTGGGGGTGTCATGG - Intronic
1167871640 19:52375641-52375663 AAAAGGTGGGAGGGGGGTGAGGG - Intronic
1168261356 19:55196840-55196862 AACTGGGGGTAGGGGTGGAGGGG - Intronic
924992414 2:323662-323684 AAAGGGTGGGAGGGGGGTGAGGG - Intergenic
925483868 2:4305988-4306010 AAAGGGTGGGAGGGGTATGAGGG + Intergenic
925706555 2:6689828-6689850 AAAGGGTGGGAGGGGGGTGATGG + Intergenic
926884895 2:17588012-17588034 GACTGGTGGAAGGGCTTTGATGG - Intronic
927722699 2:25396560-25396582 AAAGGGTGGGAGGGGGGTGAGGG + Intronic
927928214 2:27027375-27027397 CACTGGTGGTAGGGCTCTGAGGG + Intergenic
928146427 2:28781487-28781509 TGCTGGGGGTAGGGGTGGGATGG - Intronic
928175338 2:29029801-29029823 AACTAGTGGCAAGGGGGTGAGGG + Intronic
928410414 2:31049952-31049974 ACCAGGAGGTAGGGGTGGGAGGG + Intronic
928953091 2:36832459-36832481 AAAGGGTGGGAGGGGGGTGAGGG - Intergenic
929092700 2:38235298-38235320 GAAGGGTGGTAGGGGCGTGAGGG + Intergenic
929108808 2:38389105-38389127 ACCTGGTAGTAGGGTTGTGCTGG + Intergenic
929387247 2:41424077-41424099 AACTTGTGGAAAGGGTGGGAGGG + Intergenic
929567652 2:42999786-42999808 CACTGGGGGTTGGGGTGGGAGGG + Intergenic
929941801 2:46339837-46339859 ACATGGTGGAAGGGGTGAGAGGG + Intronic
931011290 2:57917280-57917302 AACTGGAGGTAAGGGAGTAAAGG - Intronic
931554192 2:63481741-63481763 AAAGGGTGGGAGGGGGGTGAGGG + Intronic
932409236 2:71535390-71535412 GACTGGTAGTAAGAGTGTGAGGG + Intronic
932880310 2:75495076-75495098 AATTGGTGGGAGGGGGGTGAGGG - Intronic
934907063 2:98214487-98214509 AGCTGGTGAAAGGGGTGAGAGGG - Intronic
935818356 2:106869092-106869114 AACTGGTGGCAGGGGAGGGGTGG + Intronic
935836262 2:107058014-107058036 AAAGGGTGGCAGGGGGGTGAGGG - Intergenic
936614574 2:114035422-114035444 AAAGGGTGGGAGGGGGGTGAGGG - Intergenic
936659329 2:114524797-114524819 AACAGGAGGTAGGGGTAGGATGG - Intronic
937056991 2:118946320-118946342 GACTGCTGGTGGGGGAGTGAGGG - Intronic
937751666 2:125482767-125482789 AAAGGGTGGGAGGGGGGTGAGGG - Intergenic
939245357 2:139616533-139616555 AAAGGGTGGGAGTGGTGTGAGGG - Intergenic
939331037 2:140761369-140761391 ACCAGGTGGTAGGGGTAAGAGGG - Intronic
940875527 2:158893641-158893663 AGCAGGTGGGAAGGGTGTGAGGG - Intergenic
940974841 2:159931147-159931169 AACTGGTGCTAAGCGTATGAGGG - Intergenic
942219369 2:173754540-173754562 AAATGGGGGGAGGGGAGTGAAGG + Intergenic
942405854 2:175653972-175653994 AAAGGGTGGGAGGGGGGTGAGGG + Intergenic
943254501 2:185576723-185576745 AAATGGTGGGAGGGGGCTGAGGG - Intergenic
944585663 2:201171151-201171173 AAAGGGTGGGAGGGGGGTGAAGG + Exonic
945400965 2:209382388-209382410 AACTCCTGGTAGGGGGATGAAGG + Intergenic
945506003 2:210641111-210641133 AACTGGGGGTGAGGGTTTGATGG - Intronic
945997816 2:216453700-216453722 AACTGGTGGCAGTGGAGAGAGGG - Intronic
946544419 2:220722035-220722057 AAATGGTGGGAGAGGTATGAGGG - Intergenic
946642092 2:221794793-221794815 TACTGGGGGTGGGGGTGTGGGGG + Intergenic
946748011 2:222864608-222864630 ATCTGCAGGTAGGGGTGGGATGG + Intronic
947372457 2:229462640-229462662 AATTGGTTGTAGGGGTAAGATGG - Intronic
947636364 2:231682548-231682570 AACTGGTTGGAGGTGTTTGAGGG - Intergenic
948065285 2:235074222-235074244 AGCAGGAGGAAGGGGTGTGATGG - Intergenic
948175709 2:235940947-235940969 AAGTGGTGGCAGGGGTGGGGTGG + Intronic
948206992 2:236167724-236167746 ATCTGGTGGTGAGGGTGTGCGGG + Exonic
948757317 2:240167235-240167257 AACTGTTGGAAAGGCTGTGAGGG - Intergenic
1170350450 20:15435023-15435045 GACGGGTGGGAGGGGTTTGAGGG + Intronic
1170927609 20:20740139-20740161 AAAGGGTGGGAGGGGGGTGAAGG + Intergenic
1170945659 20:20889022-20889044 AACTGCTGGGAGAGGTGTGGAGG - Intergenic
1171081001 20:22184746-22184768 AAATGGTGGGAGTGGGGTGAGGG - Intergenic
1171236126 20:23526536-23526558 AAGTGGGGGTAGGGGGGTGGTGG - Intergenic
1171375035 20:24686697-24686719 AAAGAGTGGGAGGGGTGTGAGGG - Intergenic
1172388814 20:34552445-34552467 AACTCGAGGTGAGGGTGTGAGGG + Intronic
1172474374 20:35226463-35226485 AACTGGAGGTCGGGGTCTGGGGG - Intergenic
1173056503 20:39618688-39618710 AACTTTTGCTAGGGGAGTGAGGG - Intergenic
1173415090 20:42847974-42847996 AAAGGGTGGGAGGGGGGTGAGGG - Intronic
1174110567 20:48195174-48195196 GACTGGGGATGGGGGTGTGAGGG + Intergenic
1174452440 20:50628626-50628648 AGCTGGTGGCAGTGCTGTGAGGG - Intronic
1174494879 20:50931870-50931892 ATCTGGCGGGAGGGGTGTGCGGG + Intergenic
1174934576 20:54853569-54853591 AACTGGTTTTTGGGGTTTGAAGG - Intergenic
1175305840 20:57974987-57975009 TAGTGGTGGTGGGGATGTGATGG - Intergenic
1176264305 20:64200812-64200834 AACAGGTGGGAGGGGTGGGGTGG + Intronic
1177858416 21:26425146-26425168 AATTGGAGGGAGGTGTGTGAGGG + Intergenic
1177983440 21:27944194-27944216 AAAGGGTGGGAGGGGAGTGAGGG - Intergenic
1178568917 21:33716453-33716475 AACTGCTGGGTGGGGTGTGAAGG - Intronic
1178576101 21:33792984-33793006 AACTGGAGATAGGGGTCTGGGGG - Intronic
1178779500 21:35588011-35588033 AAGTGGTGGGAGGTGTGTGAAGG - Intronic
1180176642 21:46093751-46093773 AAGTGGTGGCAGGGCTGTGCTGG + Intergenic
1180241102 21:46506507-46506529 AACTGTTGGAAAGGGTGTGGAGG - Intronic
1181694132 22:24584622-24584644 AGCTGGTGGCTGGGGTGTGTAGG + Intronic
1181966202 22:26658073-26658095 AACTGGAGGTGGGGGTGGGGCGG + Intergenic
1181985975 22:26800058-26800080 GACTGGGGGTTGGGGTGGGAGGG + Intergenic
1182682517 22:32092086-32092108 AACGGGTGGGAGGGGGGCGAGGG - Intronic
1182950649 22:34372549-34372571 AGCTGGCGTTAGGGGTGTGGAGG - Intergenic
1184304204 22:43584433-43584455 AAGTGGTGGTGGGGGTGGGGAGG - Intronic
1184567441 22:45300479-45300501 AGCTGGTGGTGGGGGTGAGCGGG + Intergenic
1185248003 22:49783507-49783529 GACTGGTGGTTTGGGTGTGACGG - Intronic
949629245 3:5904748-5904770 AAATGTTGGGAAGGGTGTGAAGG + Intergenic
950094798 3:10322516-10322538 AAATTGTTGCAGGGGTGTGAGGG + Intergenic
950709354 3:14803776-14803798 CACTGGGGGTAGGGGAGGGACGG + Intergenic
951049649 3:18079880-18079902 AATTGGGGGTAGGAGTTTGAAGG + Intronic
951404538 3:22279248-22279270 AAAGAGTGGGAGGGGTGTGAGGG - Intronic
952512428 3:34070788-34070810 AACTGAAGGTGGGGGTGTGAAGG - Intergenic
952998274 3:38906340-38906362 AGCTGGTGGTGGGGGAGGGATGG - Intronic
953185825 3:40637598-40637620 AAAGGGTGAGAGGGGTGTGAGGG + Intergenic
953613720 3:44470449-44470471 TACTGGTGGTGGGGGTAGGAAGG + Intronic
954656774 3:52198631-52198653 AAATGAGGGTAGGGGTATGAGGG - Intronic
955135406 3:56213028-56213050 AAAGGGTGGGAGGGATGTGAAGG + Intronic
957384368 3:79476763-79476785 AAAGGGTGGGAGGGGTGTGAGGG + Intronic
959857086 3:111172222-111172244 AGCTGGAAGTAGGGGAGTGATGG - Intronic
961421691 3:126810858-126810880 AACAGGTTGTGGGGGTGGGATGG + Intronic
962023649 3:131526073-131526095 AACTGGGTGAAGGGGTGGGATGG + Intergenic
962995123 3:140619400-140619422 AAAGGGTGTGAGGGGTGTGAGGG + Intergenic
963238995 3:142984251-142984273 AAATGGTAGTGGGGGTGGGATGG + Intronic
964115098 3:153128285-153128307 AAAGGGTGGGAGGGGAGTGAGGG - Intergenic
964452561 3:156826192-156826214 AACTGGTGGTGGGGCTCGGAAGG - Intronic
965383642 3:168020396-168020418 AGCTGGTGGTGGGCGGGTGAAGG + Intronic
965577117 3:170228866-170228888 AAAAGGTGGGAGGGGGGTGAGGG - Intronic
965740767 3:171872033-171872055 AATTGGTGGTAGTGGTGACAGGG - Intronic
966620974 3:181963851-181963873 AACTGGGAGTAGGGGAGAGAGGG + Intergenic
967573556 3:191062255-191062277 AAATGGTGGTAAGGATGTGAAGG + Intergenic
967855756 3:194116302-194116324 AAATGGTGGGCCGGGTGTGATGG + Intergenic
968280151 3:197471092-197471114 ATTTGGAGCTAGGGGTGTGAAGG - Intergenic
969572209 4:8015683-8015705 AAGTGGTGGGAGGTGTGTGTTGG + Intronic
970984757 4:22144048-22144070 AAACGGTGGGAGGGGTGTGAGGG - Intergenic
972884845 4:43472630-43472652 AACAGGTGGTAAGGATGTGTGGG - Intergenic
973532998 4:51851553-51851575 AGCTGGTGGCAGGGGTGGGGTGG + Intronic
973933139 4:55813818-55813840 AAATGGTGGGAGGGGAGTGAGGG + Intergenic
974639686 4:64611996-64612018 AAATGGTGGGAGGGCTGTAAGGG + Intergenic
975061621 4:70009947-70009969 AAAGGGTGGGAAGGGTGTGAGGG - Intergenic
975790027 4:77939057-77939079 AAAGGGTGGGAGGGGAGTGAGGG - Intronic
975798053 4:78030599-78030621 AACTTGAGGTGGGGGTGTAAGGG + Intergenic
976370044 4:84277465-84277487 AAAGGGTGGGAGGGGAGTGAGGG - Intergenic
976452565 4:85207754-85207776 AAAGGGTGGGAAGGGTGTGAGGG + Intergenic
977402717 4:96554286-96554308 AACTGGTGGCAGGGGTCTGTGGG - Intergenic
977826564 4:101539330-101539352 AAAGGGTGGGAGGGGAGTGAGGG + Intronic
978523204 4:109637750-109637772 AAATGGTGGGAGGGGGGTGAGGG + Intronic
980401395 4:132290605-132290627 AAATGGTGGGATGGGGGTGAGGG + Intergenic
980490100 4:133513446-133513468 AGAGGGTGGGAGGGGTGTGAGGG + Intergenic
980536711 4:134133688-134133710 AAAGGGTGGAAGGGGTGTAAGGG + Intergenic
980810299 4:137868822-137868844 AAATGGTGGGAAGGGGGTGAGGG - Intergenic
983229285 4:165112955-165112977 AGATGGTGGGAGGGGTGTGCCGG + Intronic
986063351 5:4212412-4212434 AGCTGGTGCTAGGGCTGTGTTGG - Intergenic
986645474 5:9912395-9912417 AAGTGGTGGTTGGGGAGAGAGGG - Intergenic
986827431 5:11536726-11536748 AAAGGGTGGGAGGGGGGTGAGGG + Intronic
988485438 5:31664858-31664880 AACTGGTGGAAGGGAGGAGATGG + Intronic
988829358 5:34972396-34972418 AAAGGGTGGGAGGGGGGTGAGGG - Intergenic
989268633 5:39506049-39506071 AATGGGTGGTAGGGGTGTAGGGG + Intergenic
989412019 5:41130909-41130931 AAAGGGTGGGAGGGGGGTGAGGG - Intergenic
990554533 5:56917944-56917966 AGCTGGTGGTAAGGAAGTGAAGG - Intergenic
991312122 5:65255394-65255416 AAAGGGTGGAAGGGGAGTGAGGG - Intronic
992251203 5:74877422-74877444 AACTGGTGGTAGAGGGGTGGGGG - Intergenic
992337227 5:75784206-75784228 AAAGGGCGGGAGGGGTGTGAGGG + Intergenic
992899160 5:81276053-81276075 AAAGGGTGGGAGGGGGGTGAGGG + Intergenic
992931564 5:81652891-81652913 AAAGGGTGGGAGGGGGGTGAGGG - Intronic
993484297 5:88463460-88463482 AAATGTTGGGAGGGGGGTGAGGG - Intergenic
993657184 5:90592451-90592473 AAAGGGTGGTAGGAGGGTGAGGG + Intronic
993743768 5:91570522-91570544 AAAGGGTGGGAGGGGGGTGAGGG + Intergenic
993821068 5:92617631-92617653 AACTGGGGGCTGGGGGGTGAGGG - Intergenic
994038145 5:95226126-95226148 AAATGGTGGGAAGGGGGTGAGGG - Intronic
994202267 5:96991048-96991070 AAAGGGTGGGAGGGGAGTGAGGG - Intronic
994966977 5:106685235-106685257 AACTGGGGGGAAGGGTGAGAAGG + Intergenic
995109203 5:108409688-108409710 AAATGATGGTATGGGAGTGAAGG + Intergenic
995130760 5:108628041-108628063 AATTGCTGGTATGGGTCTGAGGG - Intergenic
995590841 5:113698478-113698500 AAATGGTGGTAGGCATGTGCAGG + Intergenic
996105399 5:119496105-119496127 AACTGGGAGTAGGGGTGAGGAGG + Intronic
996554445 5:124763362-124763384 AAAAGGTGGGAAGGGTGTGAGGG + Intergenic
996694501 5:126379046-126379068 AAAGGGTGGGAGGGGGGTGAGGG - Intronic
996834868 5:127779873-127779895 AAAGGGTGGGAGGGGGGTGAGGG - Intergenic
997111510 5:131079873-131079895 ATGTGGTGGTAAGGTTGTGAGGG - Intergenic
998114310 5:139524573-139524595 AACAGGCGGCAGGGGTGGGATGG - Intergenic
1000685755 5:164247123-164247145 GAAGGGTAGTAGGGGTGTGAGGG - Intergenic
1000981669 5:167823440-167823462 ATTTGGTGGCAGGGGGGTGAGGG - Intronic
1001816438 5:174673202-174673224 AAATGGTGGGAAGGGGGTGAGGG - Intergenic
1001852983 5:174985529-174985551 AAATACTGGTAGGGGTGTGAGGG - Intergenic
1001911933 5:175527303-175527325 GACTTTTGGAAGGGGTGTGAAGG - Exonic
1003296941 6:4838296-4838318 AAAGGGTGGGAGGGGGGTGAGGG - Intronic
1004081676 6:12400723-12400745 AAAGGGTGGGAAGGGTGTGAGGG + Intergenic
1004520947 6:16359917-16359939 AAAGGGTGGGAGGGGGGTGAGGG + Intronic
1005017766 6:21390400-21390422 ACTTGGTGGAAGGGGTGAGAGGG - Intergenic
1005435559 6:25807600-25807622 AAAGGGTGGGAGGGGAGTGAGGG - Intronic
1006931239 6:37689879-37689901 AATAGATGGTAGGGGTTTGAGGG - Intronic
1006989681 6:38203736-38203758 AAAGGGTGGGAAGGGTGTGAAGG + Intronic
1007421462 6:41722397-41722419 GTCTGCTGGGAGGGGTGTGAGGG - Intronic
1008119789 6:47598753-47598775 AAAGGGTGGGAGGGGAGTGAAGG + Intronic
1008190758 6:48454044-48454066 AAAGGGTGGGAGGGGTGTGAGGG + Intergenic
1008526564 6:52413178-52413200 AACTGGGGGATGGGGTGTGTGGG + Intergenic
1008735840 6:54542978-54543000 AAAGGGTGGGAAGGGTGTGAGGG - Intergenic
1008774865 6:55026241-55026263 AAAGGGTGGGAGGGGGGTGAGGG - Intergenic
1011231789 6:85169993-85170015 AAAAGGTGGTAGGGAAGTGACGG + Intergenic
1011972132 6:93238812-93238834 AACAGCTGGTAGGAGTGTGTGGG + Intergenic
1013532142 6:111029865-111029887 GAATGGGGGTAGGGGTGAGATGG - Intergenic
1014937707 6:127403435-127403457 AACTGGTTGTACGGGTGGCAGGG + Intergenic
1015635447 6:135269916-135269938 CACTGGTGGTAGGGGGATGAAGG + Intergenic
1016196054 6:141341826-141341848 AAGTGGTGGTAGGGGGACGAGGG + Intergenic
1016366848 6:143328082-143328104 AATTAGTGGTAGGGTAGTGAAGG + Intronic
1016807402 6:148225574-148225596 AAAGGGTGGGAGGGGAGTGAGGG + Intergenic
1018288907 6:162270365-162270387 AAAGGGTGGGAGGGGAGTGAGGG + Intronic
1018528812 6:164742067-164742089 AAGAGGTGGGAGGGGTGAGAAGG - Intergenic
1018528880 6:164742286-164742308 AAGAGGTGGGAGGGGTGAGAAGG - Intergenic
1020154418 7:5710659-5710681 TACTGGTGCTAGGAGTGTGAAGG - Intronic
1020490987 7:8783893-8783915 GAGTGGCGGTTGGGGTGTGAAGG + Intergenic
1020647514 7:10832819-10832841 AAATGGTGGGAAGGGAGTGAGGG - Intergenic
1022494915 7:30846756-30846778 GACTGGAGGTGGGGGTGGGATGG + Intronic
1022605909 7:31813797-31813819 AAAGGGTGGGAGGGGTGTGAGGG - Intronic
1022785407 7:33632677-33632699 GACTGGCGGGAGGGGTGGGACGG - Intergenic
1024527017 7:50357466-50357488 AACTGGAGGGAGGGGTGGCAGGG - Intronic
1025857338 7:65293811-65293833 AAAGGGTGGGAGGGGGGTGAGGG - Intergenic
1027411049 7:77918199-77918221 GGGTGGTGGTAGGGGGGTGAGGG - Intronic
1027693124 7:81373381-81373403 AAAAGGTGGTAGGTGGGTGAGGG - Intergenic
1028726915 7:94098140-94098162 AAAGGGTGGGAGGGGAGTGAGGG + Intergenic
1029000047 7:97143443-97143465 AAAGAGTGGGAGGGGTGTGAGGG - Intronic
1029686030 7:102148831-102148853 AAAGGGTGGGAGGGGGGTGAGGG - Intronic
1031154404 7:118092771-118092793 AACTGGTGATGGGGATGGGATGG + Intergenic
1031740470 7:125423379-125423401 AAAGGGTGGGAAGGGTGTGAGGG + Intergenic
1031984854 7:128157482-128157504 AACTGGTGGTGGGTGGGTGTGGG - Intergenic
1032634094 7:133687254-133687276 AAAGGGTGGGAGGGGAGTGAGGG + Intronic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1034302723 7:150030742-150030764 AAGTGGTGGGAGGGGTGTGTGGG - Intergenic
1035783148 8:2244409-2244431 AGATGGTGATAGGGGTGGGAGGG + Intergenic
1035783165 8:2244449-2244471 AGATGGTGATAGGGGTGGGAGGG + Intergenic
1035808960 8:2475137-2475159 AGATGGTGATAGGGGTGGGAGGG - Intergenic
1035808977 8:2475177-2475199 AGATGGTGATAGGGGTGGGAGGG - Intergenic
1037693157 8:21200520-21200542 GACCGGTGGAAGGGGAGTGAGGG + Intergenic
1038234875 8:25743041-25743063 ATTTGGTGGTAGGGTTGGGAAGG - Intergenic
1038408218 8:27338394-27338416 AAAGGGTGGGAGGGGGGTGAGGG + Intronic
1041156449 8:54992151-54992173 ACATGGTGGTTGGGGTGGGAGGG + Intergenic
1041415499 8:57603436-57603458 AATTGGTGGTAGTTGTGTGTTGG - Intergenic
1041851474 8:62398022-62398044 AACTGGTGGGAGAGGGGTGCAGG + Intronic
1042161056 8:65895971-65895993 AAATGGTGGGAGGGTGGTGAGGG + Intergenic
1042214197 8:66413046-66413068 AAAGGGTGGGAGGGGGGTGATGG - Intergenic
1043144480 8:76635214-76635236 AAAGGGTGGGAGGGGAGTGAGGG + Intergenic
1043291202 8:78603693-78603715 AACTGACTGTAGGGGTTTGATGG - Exonic
1043402332 8:79896298-79896320 GACTGAGGGTAGGGGTGAGAGGG - Intergenic
1043448668 8:80344273-80344295 AAATGGTGGGAGGGGGGTGAGGG - Intergenic
1044407825 8:91850168-91850190 AAAGGGTGGTTGGGGTATGAGGG + Intergenic
1044666612 8:94639842-94639864 ATCTGGTGGCTGGGGGGTGATGG + Intergenic
1045878420 8:107009995-107010017 AAAGGGTGGGAGGGGGGTGAGGG + Intergenic
1046624991 8:116567176-116567198 AAAGGGTGGGAGGGGGGTGAGGG + Intergenic
1047775592 8:128067706-128067728 AACTGGAGTTAGGGGTGAGCTGG + Intergenic
1049824577 8:144660340-144660362 ATATGGTAGTAGGGGTGAGATGG - Intergenic
1049829225 8:144689283-144689305 AGCTGCTGGGAGTGGTGTGATGG - Intergenic
1050310127 9:4344241-4344263 AAATGGTAGTGGGGGTGGGAGGG - Intronic
1050847684 9:10243578-10243600 AAATTGTGGTAGCAGTGTGAAGG - Intronic
1050956045 9:11661537-11661559 AAATGTTGGTGGGTGTGTGAAGG - Intergenic
1051190154 9:14502873-14502895 AAATGGTGGGAGGGGAGTGAGGG - Intergenic
1051504446 9:17812160-17812182 AGCTGGAGCCAGGGGTGTGAGGG + Intergenic
1052811398 9:33063784-33063806 AGATGGTGGTGGGGGTGTCAGGG - Intronic
1053131897 9:35620046-35620068 AGCTGGTGGCAGGGGTGGGTGGG + Intronic
1055240911 9:74184412-74184434 AACTGGGTGTAGGTGTGTGTCGG + Intergenic
1055711834 9:79071748-79071770 AAATGGTGGGAGGGGGGTGAGGG + Intergenic
1055928709 9:81537877-81537899 AAAGGGTGGGAGGGGGGTGAGGG - Intergenic
1056133677 9:83609492-83609514 AAAGGGTGGGAGGGGGGTGAAGG + Intergenic
1056262683 9:84864354-84864376 AAAGGGTGGGAGGGGGGTGAGGG + Intronic
1056974261 9:91236243-91236265 AACTGGTGGCAGGGGTTGGGGGG + Intronic
1057431042 9:94994340-94994362 AACTGGAGGCAGGGAGGTGAGGG - Intronic
1058219837 9:102284810-102284832 AAAGGGTGGGAAGGGTGTGAGGG + Intergenic
1058832196 9:108828846-108828868 AAAGGGTGGGAGGGGTTTGAGGG + Intergenic
1059517531 9:114909659-114909681 TGCTGGTGGTGGGGGTGGGAAGG + Intronic
1059894426 9:118845420-118845442 AAAGGGTGGGAGGGGTGTGAGGG - Intergenic
1060200216 9:121648101-121648123 AACGGGTGGAAAGGGGGTGAAGG + Intronic
1060327582 9:122632561-122632583 AAGCGGTGGAAGGGGGGTGAGGG - Intergenic
1062008400 9:134253140-134253162 AACTGAGGGTAGGGATGTGTGGG + Intergenic
1185807345 X:3070717-3070739 AAAGGGTGGGAGGGGAGTGAGGG - Intronic
1185947141 X:4389416-4389438 AATGGGTGGGAGGGGGGTGAGGG - Intergenic
1185955328 X:4482841-4482863 AAAGGGTGGGAGGGGAGTGAGGG + Intergenic
1186303380 X:8226682-8226704 AAATGGTGGGAAGGGGGTGAGGG - Intergenic
1188344466 X:29046633-29046655 AACTGGAGGTAGGGGCAGGATGG - Intronic
1189108037 X:38256660-38256682 AACTGGTCACAGGGGTTTGAGGG - Intronic
1189905747 X:45757552-45757574 AACTGTTGGTAAGGATGTGTAGG - Intergenic
1190053785 X:47170518-47170540 AGCTGGTGGAGGTGGTGTGAGGG - Intronic
1190072467 X:47290634-47290656 AATTCGTGGTAGGAGGGTGAGGG + Intergenic
1190685753 X:52871279-52871301 AAAGGGTGGGAGGGGGGTGAGGG + Intergenic
1191100838 X:56726412-56726434 AACGGGTGGGAGGGGCATGAGGG + Intergenic
1191812736 X:65207485-65207507 AAATGGTGGGAAGGGAGTGAGGG + Intergenic
1194181869 X:90720330-90720352 AAAGAGTGGGAGGGGTGTGAGGG + Intergenic
1194319163 X:92422301-92422323 AAAGGGTGGGAGGGGAGTGAGGG - Intronic
1194470988 X:94296808-94296830 AAAGGGTGGGAGGGGGGTGAGGG - Intergenic
1194522196 X:94932424-94932446 AGCTGGGGGTAGGGGTGTGAAGG + Intergenic
1195783203 X:108486558-108486580 AAAGGGTGGGAGGGGTGTAAGGG - Intronic
1195844408 X:109210305-109210327 AAAGGGTGGGAGGGGGGTGAGGG - Intergenic
1196090251 X:111733278-111733300 AAATGGTGGGAAGGGGGTGAGGG - Intronic
1196152103 X:112386495-112386517 AAAGGGTGGGAGGGGGGTGAGGG - Intergenic
1196413175 X:115441979-115442001 AAAAGGTGGGAGGGGTGTGAGGG - Intergenic
1196511131 X:116513924-116513946 AAAAGGTGGGAGGGGGGTGAGGG - Intergenic
1196518883 X:116648925-116648947 AAAGGGTGGGAGGGGGGTGAGGG - Intergenic
1196663503 X:118293243-118293265 AACAGGTGGTGGGGATGTGGGGG + Intergenic
1197376187 X:125684491-125684513 AAATGGTGGGAGGGGGCTGAGGG + Intergenic
1197495282 X:127172253-127172275 ATGTGGGGGTGGGGGTGTGATGG + Intergenic
1198436718 X:136624342-136624364 AACTGGTAGTGGAGGTGAGACGG - Intergenic
1199206388 X:145153824-145153846 AAACGGTGGGAGGGGAGTGAGGG + Intergenic
1199652309 X:149958600-149958622 TAAGGGTGGGAGGGGTGTGAGGG - Intergenic
1200528495 Y:4302247-4302269 AAAGAGTGGGAGGGGTGTGAGGG + Intergenic
1200627293 Y:5535377-5535399 AAAGGGTGGGAGGGGAGTGAGGG - Intronic
1201257031 Y:12118125-12118147 GAAGGGTGGGAGGGGTGTGAGGG - Intergenic
1201271439 Y:12259355-12259377 AAAGGGTGGGAGGGGAGTGAGGG + Intergenic