ID: 1067297113

View in Genome Browser
Species Human (GRCh38)
Location 10:44980969-44980991
Sequence CCTTTTTAGCAGATAGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067297110_1067297113 21 Left 1067297110 10:44980925-44980947 CCAGTGAGTATCAAAAACAGCTC 0: 1
1: 0
2: 0
3: 17
4: 116
Right 1067297113 10:44980969-44980991 CCTTTTTAGCAGATAGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067297113 Original CRISPR CCTTTTTAGCAGATAGTGCA AGG Intronic
No off target data available for this crispr