ID: 1067297429

View in Genome Browser
Species Human (GRCh38)
Location 10:44982743-44982765
Sequence CAGTGTCCCATAAGGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067297429 Original CRISPR CAGTGTCCCATAAGGGAACA GGG (reversed) Intronic
903040411 1:20525460-20525482 CAGTGATTCATTAGGGAACATGG - Intergenic
907576930 1:55534986-55535008 CAGTGCCCCACATGGGGACAAGG - Intergenic
908331663 1:63076892-63076914 CAGTGTTCCAGAAGAGAAGAGGG + Intergenic
909394474 1:75154555-75154577 CTGGGTCCCATAAGGGAAAAAGG + Intronic
909431326 1:75590630-75590652 CCGTGGGCCTTAAGGGAACATGG + Intronic
910624466 1:89291839-89291861 CAGTGTCCCAGAAGGGGTCAGGG - Intergenic
920227993 1:204451647-204451669 CAGTTTCTCATCAGGGAAAAGGG + Intronic
920875020 1:209826912-209826934 CAGTGTCTCATAACTGAACTCGG - Intergenic
922953944 1:229583381-229583403 CAGTGTTCCATGTGGGAAGAAGG - Intergenic
923838333 1:237640049-237640071 CAGTTTCCCATGAAGGAACCAGG + Intronic
924548980 1:245056431-245056453 GAGTGTCCCAGAGAGGAACATGG + Intronic
1062763457 10:44925-44947 CAGGGGCCCAGGAGGGAACAGGG - Intergenic
1065687408 10:28300365-28300387 CAGTGTCCCACAATGCAAGAGGG + Intronic
1066092291 10:32035844-32035866 TAATGCCCCATAAGGTAACAGGG + Intronic
1067297429 10:44982743-44982765 CAGTGTCCCATAAGGGAACAGGG - Intronic
1069105706 10:64381000-64381022 CAGTGTTCCATAAGGGAACATGG - Intergenic
1070119759 10:73564637-73564659 CATTGACCCACAAGGGAACCTGG - Intronic
1072065077 10:91860471-91860493 CAGTGTCACATCTGGGAACTTGG - Intronic
1072277389 10:93836451-93836473 CAGTGTTCCAGAAGGGAGCAAGG - Intergenic
1073861584 10:107749006-107749028 CAGAGTCCCTGAAGGTAACATGG - Intergenic
1076874224 10:133208053-133208075 AAGGGTCCCATAAGCCAACATGG - Intronic
1078454307 11:11463117-11463139 CAGTCTCCCACAAGAGAACAGGG + Intronic
1079015489 11:16865322-16865344 AAGTGTCCCCTGGGGGAACAAGG + Intronic
1079086967 11:17453348-17453370 CACTGTGCCATAATGGACCACGG + Intronic
1081926876 11:46837542-46837564 CATTCTCCAATAAGGGAACCAGG + Intronic
1083591575 11:63898420-63898442 CAGTGTGCCAGAAGGGGAGATGG - Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084723341 11:70923969-70923991 CAGTGTCTCACAAGGGCACTGGG - Intronic
1085755842 11:79200579-79200601 CCGTGTCCCTTAAGGGCACCAGG - Intronic
1086434563 11:86768680-86768702 CACAGTCCCATAAGCGAAAAAGG + Intergenic
1092035408 12:5330235-5330257 CAGTGTCCCTAAGGGAAACAAGG + Intergenic
1093046895 12:14457110-14457132 CAGTGGCCCACAGGGGAAAAAGG - Intronic
1094306979 12:29031341-29031363 CAGTGTCCCATAATAAAATAGGG + Intergenic
1096861356 12:54530967-54530989 AAGTGTCATATAAAGGAACACGG + Intronic
1096883077 12:54688344-54688366 CAGTGTCCAGTGAGGGAGCAAGG + Intergenic
1098800694 12:74953615-74953637 CAATGTCCCTTAATAGAACATGG - Intergenic
1101043843 12:100784338-100784360 CTGTGTTCCAAAAGGGGACAAGG - Intronic
1101047634 12:100826613-100826635 CAGTGTAAGATAAAGGAACAGGG - Intronic
1105230619 13:18491881-18491903 CAGTGTCACATTATGGAGCAGGG + Intergenic
1113034592 13:106035450-106035472 AAATATCCCATAAGGGAAAAGGG + Intergenic
1113123477 13:106950300-106950322 AAGTCTCCCATAAGTGAGCAAGG - Intergenic
1115888690 14:38003211-38003233 CTGTGTGCCATCAAGGAACATGG + Intronic
1116769857 14:49114616-49114638 CTGTGTTCCAAAAGAGAACATGG + Intergenic
1119721028 14:76890583-76890605 CAGTGATCCAAGAGGGAACATGG + Intergenic
1122862829 14:104590173-104590195 AAGTGGCCCAGAAGGGACCATGG + Intronic
1124910958 15:33920059-33920081 CAGTGTAGAATAAGGTAACAAGG - Intronic
1128561261 15:68669372-68669394 CAGATTCCCTAAAGGGAACAGGG + Intronic
1131491957 15:92870904-92870926 CAGTGACAAATAAGGAAACAAGG + Intergenic
1136471065 16:30480583-30480605 CAGTGTTACATGAGGGAGCAAGG + Intronic
1141270401 16:82534939-82534961 CAGTGTGACATTATGGAACACGG + Intergenic
1145266425 17:21381658-21381680 CAGTGTCCCACAGGGGAATCAGG - Intronic
1146890743 17:36505035-36505057 CAGTCTCTCATCAGGGTACATGG + Intronic
1148212589 17:45817405-45817427 CAGAGTCCCAAGAGGGCACAGGG + Intronic
1148870341 17:50655491-50655513 CAGAGGACCATAAGGTAACATGG + Intronic
1150835992 17:68564831-68564853 CAGGGTCCCAGAAGAAAACAGGG - Intronic
1151194216 17:72420424-72420446 CAGTGTCCAAAAAGGGACCCAGG - Intergenic
1152956366 18:45256-45278 CAGGGGCCCAGGAGGGAACAGGG - Intergenic
1154522786 18:15247987-15248009 CAGTGTCACATTATGGAGCAGGG - Intergenic
1155056593 18:22189118-22189140 CAGTGTCCCAGAAGCACACAGGG - Intronic
1155916728 18:31564835-31564857 GAGTGTCCCAGAGGGCAACATGG + Intergenic
1156358995 18:36367458-36367480 CAGTGACCCAGAAGGCAACGCGG - Intronic
1156432981 18:37095915-37095937 CAGTGTACCATAATTGAACCGGG + Intronic
1157556461 18:48616002-48616024 CAGGGTCCCATGAGGGAGCCTGG - Intronic
1158041061 18:53094275-53094297 CAGTGTCCCAACTGGGAAGAAGG + Intronic
1158213516 18:55076108-55076130 CCTTGTCCAATAAGGCAACATGG - Intergenic
1163069353 19:14825528-14825550 GAGTGTCCCTCAAGGGAACTTGG + Intronic
1163676712 19:18659017-18659039 CAGAGACCCAGAGGGGAACAGGG - Intronic
1163930222 19:20382967-20382989 TAGTGTCACATCAGAGAACAAGG - Intergenic
1164052035 19:21592076-21592098 CAGCTTCCCATAAGGCATCAGGG + Intergenic
1166037787 19:40181751-40181773 CAGTATCCCAAGAGTGAACAGGG + Intergenic
1167502528 19:49856005-49856027 GACTGTCCCAACAGGGAACAGGG - Intronic
927402444 2:22728872-22728894 CTGTTTTCCATAAGGGAACTTGG + Intergenic
929881888 2:45843941-45843963 CTGTGTCCCAAAAGGAAAAATGG + Intronic
932280377 2:70486251-70486273 CAGTGGCCCTTAAGGGACGAAGG + Intronic
934607328 2:95706576-95706598 CCATGTCCCAAAAGGGAACCAGG - Intergenic
936732828 2:115404921-115404943 CAGTGCCACATTGGGGAACATGG + Intronic
938008724 2:127811137-127811159 CGGTGGCCCATAGGGGAAGATGG - Exonic
938256522 2:129863676-129863698 CAGTGTCCCATCAGCAAGCAGGG - Intergenic
938522072 2:132080839-132080861 CAGTGTCACATTATGGAGCAGGG - Intergenic
946410391 2:219512687-219512709 TAGTGTCCCAGAAGGGAAAGTGG - Intergenic
946663912 2:222029684-222029706 CAGTGTTCCTCAAGGGAAGAGGG + Intergenic
1168952470 20:1811772-1811794 CCGTGTCGCATAAGGTAACAGGG - Intergenic
1170135162 20:13064897-13064919 TTGTGTCCCATAAGAGAAAATGG - Intronic
1171164448 20:22957829-22957851 GGGTGCCCCATAAGGGAGCAGGG + Intergenic
1179974809 21:44858587-44858609 CAGGGTCCCGCAGGGGAACAGGG - Intronic
1180026119 21:45163281-45163303 CAAGGTCCCAAAAGGCAACAGGG + Intronic
1180166083 21:46030226-46030248 CACTGTCACCTGAGGGAACATGG + Intergenic
1180522227 22:16219944-16219966 CAGTGTCACATTATGGAGCAGGG + Intergenic
1184696539 22:46142623-46142645 CACTGTTCCATAAGGGACAATGG - Intergenic
950865763 3:16187978-16188000 CAGTGTCAGATGTGGGAACAAGG + Intronic
955062778 3:55507620-55507642 CAGTTTCCAACAAGGGAAAATGG - Intergenic
960170060 3:114450111-114450133 CAGTTTTCCAGAAGGGAAAAAGG - Intronic
960774797 3:121237376-121237398 CAGTGACCCAAAGGGGCACAGGG + Intronic
961312818 3:126014653-126014675 CATGGTCCCCTAAGGGAGCAAGG + Intronic
963103329 3:141625267-141625289 CAGGGGCCCAGAAGGGAACCTGG + Intergenic
970577758 4:17444408-17444430 CAGTGGCCTAGAAGGGAAAATGG - Intergenic
971784598 4:31084626-31084648 CAGTGTCACATAAGGAAAGCAGG + Intronic
971877381 4:32323957-32323979 CATTGTCCCATGATGGAACCAGG - Intergenic
972335730 4:38106062-38106084 CTGTATCCTATAAGGGAAAAAGG - Intronic
977965567 4:103143581-103143603 AAGTGTCCTGTTAGGGAACAGGG - Intronic
981597589 4:146445272-146445294 GCGAGTCCCATAAGGGATCAAGG - Intronic
982876462 4:160657390-160657412 CAGTGTGCAATAAGGCAAAAAGG - Intergenic
984397148 4:179216637-179216659 CAGAGTCACATAGGGGATCAGGG - Intergenic
987742901 5:21933367-21933389 CAGTGTTCTAAGAGGGAACAGGG + Intronic
992080940 5:73233900-73233922 CAAAGTCCCAAAGGGGAACAGGG + Intergenic
993796752 5:92276381-92276403 GAGTATACCATAAGAGAACAAGG + Intergenic
995221180 5:109650018-109650040 CAGTGTCCCATCTTGGAAAATGG - Intergenic
996854277 5:127987635-127987657 CAGTGTCCTATTAGGGGAAAGGG + Intergenic
996919378 5:128749786-128749808 CAGTGTCCCAAAGGGGGACTCGG + Intronic
1001124571 5:169007904-169007926 TGGTGTCCTATAAGGCAACAGGG - Intronic
1003252943 6:4448016-4448038 CAGAGTCCCATACAGGGACAAGG + Intergenic
1003294527 6:4813056-4813078 CAGTGTCCAGCAAAGGAACAAGG - Intronic
1005553190 6:26944660-26944682 TAGTTTGCTATAAGGGAACAGGG - Intergenic
1008946363 6:57101374-57101396 CTGTGTCCCATGAAGGAAGAAGG - Intronic
1011088447 6:83569564-83569586 CACTAACCCAGAAGGGAACAAGG - Intronic
1011206394 6:84903922-84903944 CACTCTCCCTTAAGGTAACATGG - Intergenic
1014974027 6:127856330-127856352 CAGAGTCCCAATAGGTAACAGGG + Intronic
1018401008 6:163419974-163419996 CAGTTTCCCATAAGAGCAAATGG + Intronic
1018479208 6:164173394-164173416 CAGGGTCCCAACAGGAAACATGG + Intergenic
1019729967 7:2624179-2624201 CAGGGTCCCCCAAGGGGACATGG + Intergenic
1023529905 7:41141859-41141881 CAGTGTCCCAAAAGAGAATATGG - Intergenic
1024174636 7:46826448-46826470 CTGTTTCCCATCAGGGAAAAGGG + Intergenic
1027237010 7:76304022-76304044 CAGTGTGCCCTCAGGGGACAGGG - Exonic
1027595384 7:80167364-80167386 CAGTGTCACAAAAGTGAAGATGG + Intronic
1028108204 7:86905406-86905428 CAATTTCCCATCAGGGCACAAGG - Intronic
1030821775 7:114101493-114101515 CAGTGTCAGAAAAGGAAACAAGG + Intronic
1031127485 7:117791407-117791429 CAGTTTGCCACAAGGGAACAGGG - Exonic
1033019562 7:137709257-137709279 CAGTGGCCCATAAGAGAAAGAGG - Intronic
1036920396 8:12848146-12848168 CCGTGTCCCTTACAGGAACATGG + Intergenic
1037874566 8:22534962-22534984 TATTGTCCCAGAAGGGCACAGGG + Intronic
1041758582 8:61339521-61339543 CAGTGCCCCATAAGGGACATGGG - Intronic
1042084240 8:65089875-65089897 TAGAGTGCCATAGGGGAACAAGG - Intergenic
1042099407 8:65258273-65258295 AAGTGTTTCATAAAGGAACAAGG + Intergenic
1044423983 8:92030310-92030332 TAGTGTCCCATAAGGAAATGGGG + Intronic
1045908314 8:107375350-107375372 CAGGGTACCTCAAGGGAACAAGG - Intronic
1048373349 8:133799863-133799885 CAGTGTATCATAAGGGAGAAAGG + Intergenic
1049319427 8:141988100-141988122 CAGGGTCACAAAAGGGAGCATGG - Intergenic
1051645891 9:19268010-19268032 CACTTTCCCATAAAGGAAGATGG - Intronic
1052744339 9:32425078-32425100 AAGTGTCCAATAAGGGAAAGGGG - Intronic
1053147126 9:35719274-35719296 CAGGGTCCCCTAAGGGGAAAAGG + Exonic
1053283927 9:36838577-36838599 CAGTTTCCCACAAGGGAAGTTGG + Exonic
1053700767 9:40687969-40687991 CAGTGTCACATTATGGAGCAGGG - Intergenic
1054312060 9:63487367-63487389 CAGTGTCACATTATGGAGCAGGG - Intergenic
1054410834 9:64811424-64811446 CAGTGTCACATTATGGAGCAGGG - Intergenic
1055054117 9:72008010-72008032 CAGTGTGCCCTCAGGGGACAGGG + Intergenic
1055867126 9:80828184-80828206 TATTGACCCAAAAGGGAACAAGG - Intergenic
1055978809 9:81980457-81980479 CATTCTCCAATAAAGGAACAAGG - Intergenic
1061293314 9:129664759-129664781 CGGTTTTCCATATGGGAACAGGG + Intergenic
1061330023 9:129886334-129886356 CAGTGTGGCACAAGGGAACAAGG - Intergenic
1062741837 9:138179523-138179545 CAGGGGCCCAGGAGGGAACAGGG + Intergenic
1188125179 X:26358866-26358888 AAGTATCCCAAAAGGGAGCATGG - Intergenic
1190330779 X:49234034-49234056 CAGTGTGCCCTCAGGGGACAGGG + Intergenic
1193864414 X:86712795-86712817 TAGTGAGCCATAAGTGAACACGG + Intronic
1194083927 X:89502633-89502655 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1194637365 X:96362466-96362488 CAGTGTCTCATAACAAAACATGG - Intergenic
1195405986 X:104513912-104513934 CAGTGACCCAAAAGGGAAATAGG - Intergenic
1200077086 X:153556564-153556586 CAGGGGCCCATGAGGGAACCAGG + Intronic
1200436574 Y:3158513-3158535 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1200879981 Y:8202548-8202570 CATTGCCCCATATGGGAGCAGGG + Intergenic