ID: 1067300206

View in Genome Browser
Species Human (GRCh38)
Location 10:45001055-45001077
Sequence CAACGAGGGCGGCGCGGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 178}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067300199_1067300206 -1 Left 1067300199 10:45001033-45001055 CCGCTCGGGAGCGCGCTGGCCGC 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1067300206 10:45001055-45001077 CAACGAGGGCGGCGCGGGCCCGG 0: 1
1: 0
2: 0
3: 16
4: 178
1067300195_1067300206 19 Left 1067300195 10:45001013-45001035 CCTGCGTCGGATACTCGGGTCCG 0: 1
1: 0
2: 0
3: 1
4: 8
Right 1067300206 10:45001055-45001077 CAACGAGGGCGGCGCGGGCCCGG 0: 1
1: 0
2: 0
3: 16
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067300206 Original CRISPR CAACGAGGGCGGCGCGGGCC CGG Intronic
900242452 1:1623536-1623558 CGGCGAGGGCGGCGTGGGCACGG + Exonic
900393518 1:2443893-2443915 CAGCGAGGGCGGCGGGGGCGGGG - Intronic
901500989 1:9652447-9652469 CAACGCGGGAGGCCCGGGACTGG - Intronic
901627285 1:10631454-10631476 GAGCGGGGGCGGCCCGGGCCTGG - Intergenic
901696545 1:11012297-11012319 CAGCGAGGGCGGGGCGGGGCGGG - Intergenic
902585824 1:17438265-17438287 CAAGGCGGGCGGCGCGGCCGTGG - Exonic
903134841 1:21302733-21302755 CAAAGGGGGCAGGGCGGGCCAGG - Intronic
904592654 1:31623618-31623640 CAGCCAGGAAGGCGCGGGCCCGG - Exonic
905580729 1:39081482-39081504 CAGCGAAGGCGGCGGCGGCCGGG - Intronic
905867103 1:41382360-41382382 CGAGGCGGGCGCCGCGGGCCTGG + Exonic
906225543 1:44118733-44118755 CTGCGAGGGCGGCGCAGGGCGGG + Intergenic
906520912 1:46466508-46466530 CGAGGAGGGCGGGGCGGGGCGGG - Intergenic
907069186 1:51518944-51518966 CGGCGAGGGCCGCGCGGGGCGGG + Intronic
908501207 1:64745199-64745221 CGGCGAGGGGGGCGCGGGCCTGG + Exonic
922775569 1:228212980-228213002 CAAAGGGGGCGGGGCGGGCAGGG - Intronic
923782950 1:237042270-237042292 GGAGGAGGGCGGCCCGGGCCCGG - Exonic
924801436 1:247331743-247331765 CGAGGAGGGCGGGGCGGGGCCGG + Exonic
1067300206 10:45001055-45001077 CAACGAGGGCGGCGCGGGCCCGG + Intronic
1067661198 10:48237402-48237424 CAAGGAGGACAGTGCGGGCCAGG + Intronic
1073297671 10:102450869-102450891 CCACCAGGGCGGCGCGGCCTCGG + Exonic
1073363628 10:102919142-102919164 CCACGGGGGCGGCGGGAGCCCGG - Exonic
1074182896 10:111078803-111078825 CCCCGAGCGCAGCGCGGGCCCGG + Exonic
1074522713 10:114239791-114239813 CCACGAGGGAGGCGCGCGCCAGG - Intronic
1074865457 10:117542240-117542262 CAGCGGAGGCGGCGCCGGCCAGG + Intergenic
1076776484 10:132700641-132700663 CACAGAGGGAGGGGCGGGCCCGG - Intronic
1077010488 11:377112-377134 CAGCGAGGAGGCCGCGGGCCCGG + Exonic
1077043115 11:533231-533253 CAGTGAGGGAGGCGAGGGCCGGG - Intronic
1077043686 11:535337-535359 CAATACGCGCGGCGCGGGCCGGG - Intronic
1077204654 11:1336683-1336705 CGGCGAGGGCGGGGCGGGGCGGG + Intergenic
1077308471 11:1878227-1878249 CACAGAGGGCGGCGCAGGCTGGG - Intronic
1078139665 11:8682945-8682967 CAGGGTGGCCGGCGCGGGCCCGG + Intronic
1078788503 11:14520296-14520318 CCATGGTGGCGGCGCGGGCCTGG + Intronic
1080387366 11:31817992-31818014 CAATGAGGACGGCGCTGGCGTGG - Intronic
1082816888 11:57514999-57515021 GAACGCGGGCGGCGCGGGGGCGG + Intronic
1083342654 11:61968298-61968320 CAACAAAGGCTGGGCGGGCCGGG + Intergenic
1084112523 11:67023303-67023325 CGAGGAGCGCGGCGCGGGCCGGG - Intronic
1084265612 11:68003869-68003891 CGGCGGGGGCGGGGCGGGCCGGG - Intronic
1086337160 11:85811255-85811277 CGAGGAGGCCGGGGCGGGCCGGG - Intergenic
1091434177 12:460387-460409 CAGCGGGGGCCGCGCGGCCCGGG - Exonic
1092659474 12:10722955-10722977 CGACGTGGGCGGCGGGCGCCGGG + Exonic
1094466103 12:30754997-30755019 GGCCGAGGGCGGAGCGGGCCGGG - Intergenic
1098898108 12:76085030-76085052 CGAAGGGGGCGGGGCGGGCCGGG - Exonic
1100611403 12:96194362-96194384 CGGCGGGGGAGGCGCGGGCCTGG + Exonic
1101131834 12:101697881-101697903 CAGCCAGCGCGGCGCGGACCCGG - Exonic
1101640183 12:106581827-106581849 GAAAGAGGGGGGCGAGGGCCGGG - Intronic
1102197071 12:111033766-111033788 CAGCGAGCGCTCCGCGGGCCCGG + Intergenic
1110705976 13:78602266-78602288 CGGCGCGGGCGGCGCGGGCGCGG - Exonic
1112574946 13:100627285-100627307 CCACGAGGCCGGCGCGGGGCGGG + Intronic
1113311919 13:109140598-109140620 CGACGACGGCGGCCCGGGCGCGG + Exonic
1115855055 14:37622238-37622260 AAACGCGCGCGGGGCGGGCCGGG - Intronic
1118312513 14:64704373-64704395 GAGCGAGGGAGGGGCGGGCCAGG - Intronic
1118314244 14:64716039-64716061 CCACGAGGGTGGCGAGGGGCCGG - Intronic
1121326877 14:93025296-93025318 CAACGTGGGCGGCGCTAGGCAGG - Intronic
1122317933 14:100836576-100836598 CCCCGAGAGCGGCTCGGGCCAGG + Intergenic
1122399248 14:101457730-101457752 CCGGGAGGGAGGCGCGGGCCTGG + Intergenic
1122418298 14:101560711-101560733 CGGCCAGGGCGGCGCGGGCTGGG + Intergenic
1122965126 14:105119921-105119943 CAAGGAGAGAGGTGCGGGCCTGG + Intergenic
1126668424 15:51094700-51094722 CGGCGCGGGCGGCGCGGGCTGGG + Intronic
1127439099 15:58988118-58988140 CAACGGGGGAGGGGCCGGCCTGG + Intronic
1131179492 15:90230328-90230350 CAACGAGGGCCGCCCCTGCCCGG + Exonic
1131676390 15:94674712-94674734 CAACCCGGGCAGCTCGGGCCTGG + Intergenic
1132079489 15:98852345-98852367 CCACGGCGGCGGCGCGGGCGCGG - Intronic
1132728998 16:1351551-1351573 CGGCGAGGGCGGCCCGGGCCCGG - Exonic
1132841321 16:1979699-1979721 CACCGCGGGCAGGGCGGGCCAGG - Exonic
1133272406 16:4616629-4616651 CAACGAAGGAGGCTGGGGCCAGG - Intronic
1134084286 16:11345854-11345876 GAACGGGGGCGGGGCGGGTCTGG + Intronic
1136641525 16:31569344-31569366 CGACGAGGGCGGCGGGCGCCGGG + Intergenic
1137555025 16:49465059-49465081 CAGCGAGGTGGGCGCGGGCGAGG + Intergenic
1142006101 16:87690250-87690272 CAGCAAGGGCGGCGCCTGCCGGG + Exonic
1142194786 16:88734365-88734387 CAGCGCGGGAGGCGCGTGCCAGG + Exonic
1142379042 16:89721487-89721509 CGAGGCGGGCGGGGCGGGCCAGG - Intronic
1143527302 17:7479829-7479851 CACCGAGCGGGGCGCGGGCCGGG + Intronic
1144909964 17:18672710-18672732 CGACGAGGACGGCGGGGGACGGG - Intronic
1145765530 17:27456301-27456323 CAGGGAGGGCGGCGCGGGCGCGG + Intergenic
1145904337 17:28508015-28508037 CAGCGCGGGCGGGGCGGGGCTGG - Intronic
1145941216 17:28744278-28744300 CAGCGGGGGCGGGGCGGGGCGGG + Intronic
1146058755 17:29593714-29593736 GAAGGAGGTCCGCGCGGGCCAGG + Exonic
1146281747 17:31549567-31549589 CAAGAAGGGCGGCGCGGCCGGGG - Intergenic
1151602437 17:75114406-75114428 CTATGGGGGCGGCGTGGGCCTGG + Intronic
1151954519 17:77373719-77373741 CCACGTAGGCGGCGCGGGCACGG - Intronic
1152226303 17:79094419-79094441 CACCCAGGGCTGGGCGGGCCTGG + Intronic
1152824958 17:82458827-82458849 CAAGGTGAGCGCCGCGGGCCGGG + Exonic
1153040884 18:812236-812258 CAACGACGGCAGAGCCGGCCCGG + Intronic
1154161056 18:11981282-11981304 CAACGGGTGCGGGGCGGGGCCGG + Intronic
1157146374 18:45166894-45166916 CAAAGAGGGCGGCACCAGCCTGG + Intergenic
1158962143 18:62596238-62596260 GGAGGACGGCGGCGCGGGCCGGG + Intergenic
1160521747 18:79511902-79511924 AACAGAGGGCGGCACGGGCCTGG + Intronic
1160812976 19:1020933-1020955 CAACGGCGGCGGCGGCGGCCCGG - Exonic
1160864442 19:1250725-1250747 CTGCGAGGGCGTCCCGGGCCGGG + Intronic
1160947899 19:1652066-1652088 CGACGGGGGCGACGCGGGCCTGG + Intronic
1161050969 19:2163996-2164018 CAAAGAGGGAGTCGGGGGCCGGG + Intronic
1161175814 19:2841677-2841699 CGGCGAGGGCGGCGCAGGACGGG + Intronic
1162013213 19:7830379-7830401 CAGGTAGGGCGGCGCGGGCCGGG + Intronic
1162346220 19:10119524-10119546 CAAGGAGGATGGCGCGGGGCAGG + Intronic
1162479768 19:10921445-10921467 TAACGAGGGTGGCGGGGGCAGGG + Intronic
1163437317 19:17303244-17303266 CATCGAGGGCCGCGGGGCCCGGG + Exonic
1163664141 19:18595189-18595211 CAGCAGGGGCGGCGGGGGCCGGG - Intronic
1165015408 19:32876683-32876705 CAAGGAGGGCGGGGCAGGCAAGG - Intergenic
1165090889 19:33387928-33387950 TAAGGAAGGAGGCGCGGGCCGGG + Exonic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1165745989 19:38229651-38229673 CAGAGCGGGCGGCGCAGGCCGGG - Intronic
926422923 2:12716820-12716842 CAATGAGGGGGGCCCGGGCGGGG + Intergenic
927216626 2:20671068-20671090 CAGCGGCGGGGGCGCGGGCCGGG + Exonic
932073525 2:68643642-68643664 CAGGGAGTCCGGCGCGGGCCGGG + Exonic
932753927 2:74391866-74391888 CCACGAGGGCGGGGAGGGCGGGG - Intronic
935904644 2:107828415-107828437 CATCGAGGCCGCCGCGGGGCCGG - Intronic
935904771 2:107828915-107828937 CATCGAGGCCGCCGCGGGGCCGG - Intronic
936433262 2:112482223-112482245 CGGCGCGGGCGGCGGGGGCCGGG + Exonic
936512247 2:113157576-113157598 CGTCGAGGGCGGCGACGGCCGGG - Intronic
937283505 2:120736134-120736156 CAGCCGGGGCGGGGCGGGCCAGG - Intronic
942150977 2:173075927-173075949 CGACGAGGGCGGCGGGGGTTGGG - Intronic
942278887 2:174342085-174342107 CCACGCGGGCCTCGCGGGCCGGG - Intergenic
942452318 2:176116161-176116183 CAAAAAGGGCCGCGAGGGCCGGG - Intronic
942890302 2:180980400-180980422 CAAAGAGCGCGGCGGGGACCCGG - Intronic
946325089 2:218980953-218980975 GAAGGAGGGTGGCGCGGGCTTGG - Intergenic
948824608 2:240568309-240568331 AATCGAGCGCGGCGCGGGGCCGG - Intronic
1169191418 20:3660985-3661007 GCAGGAGGGCGGCGCGGGGCCGG + Exonic
1170871396 20:20209925-20209947 CAGTGAGGGCTGCGGGGGCCTGG - Intronic
1172771450 20:37384672-37384694 GAAGAAGGGCGGCGCGGGACCGG + Intronic
1172876143 20:38165374-38165396 CAGCGCTGGCGGCGTGGGCCCGG - Intronic
1173166237 20:40688960-40688982 GAGCGAGGGCGCAGCGGGCCGGG + Exonic
1173279946 20:41618698-41618720 CCACGGGGGCGGGGCGGGGCCGG + Intergenic
1175199117 20:57266158-57266180 CACCTGGGGCGGTGCGGGCCCGG - Exonic
1175220109 20:57411918-57411940 CAACGACGGCAGCGTGGGCCAGG + Intergenic
1176029796 20:63006470-63006492 CGGCGGCGGCGGCGCGGGCCAGG - Exonic
1176080862 20:63272525-63272547 CAACGGGGGCGGGGCGGGTGGGG - Intronic
1179968274 21:44818882-44818904 CATGGAGGCCGGGGCGGGCCAGG - Intergenic
1180014968 21:45075499-45075521 CGCCGCGGGCGGCCCGGGCCAGG + Intronic
1180064247 21:45404941-45404963 CTGCGAGGACGGGGCGGGCCGGG - Intergenic
1181652991 22:24271150-24271172 GAACGAGGACGGCGCGGGAAGGG - Intronic
1182547555 22:31084883-31084905 CCACGAGGCCAGCGGGGGCCGGG - Intronic
1183950589 22:41350465-41350487 CAGGGAGGGTGGCTCGGGCCAGG + Intronic
1185037916 22:48489418-48489440 GAGCGCGGGCGGCGCGGGCGCGG + Intergenic
1185317683 22:50186023-50186045 CACCGAGCGGGGGGCGGGCCCGG + Intronic
1185398425 22:50604070-50604092 GGACGCGGGCGGCGCGCGCCTGG + Exonic
950509966 3:13420209-13420231 CGAGGATGGCGGCGCGGGGCCGG - Exonic
954384250 3:50236154-50236176 CACCGACGGCGGGGCGGGCCGGG - Exonic
955911618 3:63864079-63864101 CAAGGGGGGCGGCGGGAGCCCGG - Intergenic
958798712 3:98732809-98732831 AAAGGAAGGTGGCGCGGGCCAGG - Exonic
963061761 3:141231910-141231932 CGGTGAGTGCGGCGCGGGCCTGG + Exonic
968010436 3:195270846-195270868 CAGCGCGGGCGGCGAGGGCGCGG + Exonic
968434107 4:576190-576212 CGGCGGCGGCGGCGCGGGCCCGG - Intergenic
968729123 4:2261535-2261557 CGGCGAGGGCGGGGCCGGCCGGG + Intronic
968820171 4:2844036-2844058 TAGCGGGGGCGGCGGGGGCCCGG + Intronic
969619068 4:8269889-8269911 CAACGAGGCCGCTGCGGGGCCGG - Exonic
969620005 4:8274126-8274148 CACCGAGGGTGATGCGGGCCAGG - Intronic
971406212 4:26322098-26322120 CCAGGAGGGGGGCGGGGGCCGGG - Intronic
972311879 4:37890420-37890442 CAACATGGGGGGCGGGGGCCGGG - Intergenic
978282788 4:107036993-107037015 CTACGAGTGCGGCGGGGCCCGGG - Intronic
989744334 5:44809544-44809566 CACCGAGGGCGGCAGCGGCCAGG - Exonic
993905693 5:93621180-93621202 CGGTGAGGGCGGCGAGGGCCAGG + Intronic
996978415 5:129461187-129461209 CAGCGGGGGCAGCGCGGACCCGG + Exonic
997635198 5:135399347-135399369 CAACGGGTAGGGCGCGGGCCCGG - Exonic
1001056963 5:168457719-168457741 CAACGGGGCCGGTGGGGGCCAGG - Intronic
1002270868 5:178071063-178071085 CAAAGAGAGCAGCGAGGGCCAGG - Intergenic
1003094723 6:3133293-3133315 CAACGAGGCTGGCGGGAGCCTGG - Intronic
1003212297 6:4078983-4079005 CAAAGAGGGCGGCGGGCGGCTGG + Exonic
1003873298 6:10417827-10417849 GAAGGAGGGAGCCGCGGGCCTGG - Intronic
1006309556 6:33248340-33248362 CGAAGAGGGCGGCGGGGACCGGG + Intergenic
1006377244 6:33678361-33678383 CAAGGAGGGAGGCGAGGCCCTGG - Intronic
1006472146 6:34235432-34235454 CAAAGGGGAGGGCGCGGGCCTGG - Intergenic
1007591182 6:43021729-43021751 CGAGGAGGACGGCGGGGGCCTGG + Exonic
1007783144 6:44265449-44265471 GAAGGAGGCCGCCGCGGGCCGGG - Exonic
1013273348 6:108561403-108561425 CGACGAGGACGGCGGGGGACGGG + Exonic
1015024853 6:128520422-128520444 CCACGACGGAGGAGCGGGCCGGG + Exonic
1016010655 6:139135150-139135172 CCGCGCGGGCGCCGCGGGCCCGG - Exonic
1017954812 6:159169273-159169295 CGACGGGGGCGGCGGGGCCCGGG - Intergenic
1018876762 6:167827544-167827566 CCGCGAGCGCGGCGCGGCCCCGG + Intronic
1019474286 7:1236566-1236588 GCTCAAGGGCGGCGCGGGCCTGG + Exonic
1020014138 7:4821118-4821140 CTTCGAGGGAGGCGCAGGCCCGG - Intronic
1020130124 7:5555072-5555094 CCACGTGAGCCGCGCGGGCCTGG - Intronic
1021828023 7:24573695-24573717 CGAGGGGGGCGGGGCGGGCCAGG - Intronic
1027211215 7:76150348-76150370 CAGCCACGGCGGCGGGGGCCTGG - Intergenic
1029372453 7:100158301-100158323 CACCGGGGGCGGCCCGGGCTTGG - Exonic
1032087255 7:128890798-128890820 CGACGTGGGCGGAGCGGGCCTGG + Intronic
1036723850 8:11201470-11201492 GAACGAGGGGGGAGTGGGCCAGG + Intergenic
1037390479 8:18387105-18387127 CCACGAGGCCGGCGCGCTCCAGG + Intergenic
1038176343 8:25184719-25184741 GACCGCGGGCGGCGCGGGCACGG + Intronic
1043147276 8:76674128-76674150 CAACCAGAGCAGCGCGGGGCAGG + Intergenic
1045305370 8:100952581-100952603 CACGGAGGGTGGGGCGGGCCGGG - Intronic
1046108188 8:109691479-109691501 TAAGGCGGGCGGAGCGGGCCGGG - Exonic
1049585089 8:143429312-143429334 CGGCGACGGCGGCGCGGGCTCGG + Exonic
1050512903 9:6413405-6413427 CAGGGAAAGCGGCGCGGGCCGGG + Exonic
1053013103 9:34646610-34646632 CATCGGGGGCGGCGCGGGGAGGG + Intronic
1058866653 9:109167177-109167199 CAGCGGGGGCGCCGCGGGCGCGG + Exonic
1060793558 9:126500843-126500865 CAAGGAGGGCTTCGCGGGGCAGG - Intronic
1060945912 9:127569198-127569220 GACCGAGGGCGGGGCGGGGCGGG - Intronic
1061129952 9:128703074-128703096 CTGCGAGGGCGTCGCGGGGCCGG - Intronic
1061320330 9:129824088-129824110 CAAGCAGGGTGGCGCGGGTCCGG - Exonic
1061502018 9:131009403-131009425 CCACGTGGGCGCCGCGGGCGCGG + Exonic
1061961875 9:133992705-133992727 CGACGCGGGCGGCCCAGGCCCGG - Intergenic
1062306116 9:135907814-135907836 CAACGGGGCAGGCGCGGACCAGG - Intergenic
1189160383 X:38804103-38804125 CAGCGGGGGCGGGGCGCGCCGGG - Exonic
1189534526 X:41923205-41923227 GAGCGAGGGCGGCCCGGGCCCGG + Intronic
1190266867 X:48831921-48831943 CGACGACGGCCCCGCGGGCCCGG - Exonic