ID: 1067300467

View in Genome Browser
Species Human (GRCh38)
Location 10:45003497-45003519
Sequence CAGTAGACTCAGAAGAAGCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 283}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067300466_1067300467 25 Left 1067300466 10:45003449-45003471 CCGGCAGCGGCAGAAGTGGGGCA 0: 1
1: 0
2: 1
3: 32
4: 197
Right 1067300467 10:45003497-45003519 CAGTAGACTCAGAAGAAGCTTGG 0: 1
1: 0
2: 0
3: 24
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067300467 Original CRISPR CAGTAGACTCAGAAGAAGCT TGG Exonic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
903827136 1:26154685-26154707 CCTTAGACTCTGAAGTAGCTGGG - Intergenic
904085358 1:27903020-27903042 CAGGAGAATCAGTTGAAGCTGGG - Intronic
905246070 1:36614718-36614740 CAGTAGAACCTGAGGAAGCTGGG + Intergenic
905900378 1:41577533-41577555 AAGTGGACTCTGAACAAGCTGGG + Intronic
906411054 1:45579939-45579961 CAGGAGACTCAGTTGAACCTGGG - Intergenic
907525435 1:55051245-55051267 CAGAAGACTCAGGAGACCCTGGG + Intronic
909430310 1:75580743-75580765 CAGGAGAATCAGTAGAACCTGGG + Intronic
910285654 1:85551409-85551431 AAGTGTGCTCAGAAGAAGCTGGG - Intronic
913241290 1:116832175-116832197 GAGGAGACTCAGAAGATGGTGGG - Intergenic
914835270 1:151201440-151201462 CAGGAGACTCATTCGAAGCTGGG - Intronic
915681451 1:157585644-157585666 CAGGAAACTCACAAGAAGCAGGG - Intronic
917336071 1:173925497-173925519 CAGTAACCACAGCAGAAGCTGGG - Intergenic
917801772 1:178577917-178577939 CAGAAGTCTCAGAGTAAGCTCGG - Intergenic
918508440 1:185283230-185283252 CATAAGACACAGAAGAACCTTGG + Intronic
919729264 1:200902448-200902470 CAGTAAACTCAGAAGACAGTGGG + Intronic
920514151 1:206572075-206572097 CAGTAGTCTCAGAAGTAAATGGG + Intronic
921377598 1:214490719-214490741 CTGTAGCCTCCGAAGTAGCTGGG - Intronic
922115516 1:222609071-222609093 CAGAAGGCTCAGAAGAAGATAGG - Intergenic
922849006 1:228716026-228716048 CAGCAGACTCCCAAGTAGCTGGG + Intergenic
922958206 1:229623403-229623425 CAGTAGAGTAAGAAGAACCAAGG - Intronic
923511419 1:234656968-234656990 CAGTAGACTTAGAGGTAGCCCGG + Intergenic
923715795 1:236423988-236424010 CCCTAGACTCCCAAGAAGCTAGG - Intronic
924047823 1:240050464-240050486 GAGAAGACTCAGAAGCTGCTGGG + Intronic
924105538 1:240645499-240645521 CTGTGGAATCAAAAGAAGCTGGG - Intergenic
924529993 1:244885385-244885407 CAATAGTTTCATAAGAAGCTGGG + Intergenic
924640303 1:245827230-245827252 CTGTAGAGTCAGAGGGAGCTGGG - Intronic
924915602 1:248564908-248564930 CAGGAGACTCAGTCGAACCTAGG + Intergenic
924939990 1:248806488-248806510 CACTAGCCTCAGGAGTAGCTAGG + Intergenic
1063559478 10:7113061-7113083 CAGTGGCATCAGGAGAAGCTGGG - Intergenic
1064480555 10:15736373-15736395 CAGGAGACTCACTTGAAGCTGGG - Intergenic
1065764315 10:29012888-29012910 CAGGAGAATCACATGAAGCTGGG - Intergenic
1067300467 10:45003497-45003519 CAGTAGACTCAGAAGAAGCTTGG + Exonic
1068094347 10:52471806-52471828 CAGAAGACTTGGAAGAATCTAGG + Intergenic
1068658390 10:59597336-59597358 CAGTAGAGACAGAAAGAGCTAGG + Intergenic
1068981744 10:63070012-63070034 CTGTAGACTCAGAAAATGGTTGG + Intergenic
1069475833 10:68731704-68731726 CCTCAGCCTCAGAAGAAGCTGGG + Intronic
1069927785 10:71863066-71863088 CAGTGGACTGAGAACACGCTTGG + Intergenic
1070707063 10:78647514-78647536 CAGCAGACTCAGAAGATGGAAGG - Intergenic
1071605619 10:86985757-86985779 CAAGAGACTCAGAAGAAACAGGG - Intergenic
1071814781 10:89221260-89221282 CAGGAGAATCACATGAAGCTGGG + Intronic
1073938943 10:108671099-108671121 CAGTTAACTCAGAAGAATCCAGG + Intergenic
1074379241 10:112965226-112965248 CAGGACACTCATCAGAAGCTGGG - Intronic
1076216900 10:128702041-128702063 AAGTGGACTCAGCAGAAGATGGG + Intergenic
1076636167 10:131883692-131883714 GAGAAGGCTCTGAAGAAGCTGGG - Intergenic
1077141563 11:1027075-1027097 CAGGACACTCAGAGGAAGCCGGG + Intronic
1077617214 11:3685381-3685403 CAGTGGACACAGAAAAAGCAGGG + Intronic
1078134351 11:8639986-8640008 CAGTATACTCCGGAGTAGCTTGG - Intronic
1078375956 11:10793169-10793191 AAGGAGACTGAGGAGAAGCTGGG + Intergenic
1078523025 11:12078401-12078423 CAGAAGAGTCACAAGAACCTGGG + Intergenic
1078614291 11:12850614-12850636 CAGTTTCCTCAGAAGAATCTAGG + Intronic
1079433681 11:20422860-20422882 CAGGGGACTCAGAAGAAGTAGGG + Intronic
1081026129 11:38017428-38017450 CTGTAGACTCAGGAGTAGGTGGG - Intergenic
1081589841 11:44414363-44414385 CTGTAGTCTCATCAGAAGCTTGG + Intergenic
1082183391 11:49147809-49147831 CAGCAGCCTCCAAAGAAGCTAGG - Intronic
1082922369 11:58509402-58509424 GAGCAGACTCAGAAGAAGTGAGG + Intergenic
1085194983 11:74664802-74664824 CAGTAGAGTCAGAAAGAGCTGGG + Intronic
1086065067 11:82734915-82734937 CAAGAGATTCAGAAGAGGCTTGG + Intergenic
1087618782 11:100519071-100519093 TAGAGGACTCAGAAGAAGATGGG - Intergenic
1089080329 11:115771180-115771202 GAGCAGACACAGAATAAGCTGGG + Intergenic
1089185030 11:116608940-116608962 CCGTAGACCTAGAAGAAACTCGG + Intergenic
1089291120 11:117438455-117438477 CAGCAGGCTCAGAAGCACCTGGG + Intronic
1089472008 11:118729070-118729092 TTGTGGGCTCAGAAGAAGCTAGG - Intergenic
1089529558 11:119117595-119117617 CTGTTGCCTCAGAAGAAACTGGG + Exonic
1090447955 11:126780273-126780295 TAGTGGACTCGGAAGAAGATAGG - Intronic
1092779980 12:11977452-11977474 CAGTAGCCTCCGAAGTAGCTGGG - Intergenic
1096614324 12:52823157-52823179 AAGGATGCTCAGAAGAAGCTTGG - Exonic
1097384044 12:58928188-58928210 CACTAGAGTCAGAAGAAGCAAGG + Intergenic
1097558255 12:61167157-61167179 TAGAAGACTCAGAAGAAGACAGG - Intergenic
1098373875 12:69791226-69791248 CTGTAAACTCAGAAGAAACAAGG + Intronic
1099507661 12:83499526-83499548 CGGAGGACTCAGAAGAAGATGGG + Intergenic
1100022883 12:90091076-90091098 CAGTAGACTGAGAAGATTGTGGG + Intergenic
1100322188 12:93506221-93506243 TTGAAGACTCAGAAGAGGCTGGG - Exonic
1103039985 12:117686943-117686965 GAGAGGACTCAGAAGATGCTGGG + Intronic
1103434263 12:120912750-120912772 CAGTTAACTCAAAAGAAGGTAGG - Intergenic
1104343795 12:127977460-127977482 CAGGACACTAAGAAGAAGCAAGG + Intergenic
1106365547 13:29075954-29075976 CAGAAGAGTGAGAAGAAGATAGG + Intronic
1107025620 13:35798399-35798421 CTGTAAACTCAGGAGAAGCATGG + Intronic
1108067652 13:46595019-46595041 CTATAAACTCAGAAGAAGCTAGG - Intronic
1108588516 13:51892119-51892141 CAGGAGACTCAGATGAGGCAGGG - Intergenic
1110812406 13:79825466-79825488 CAGAAGGCTCAGAGGAATCTTGG - Intergenic
1113594878 13:111524060-111524082 AAGTAGCCACAGATGAAGCTAGG - Intergenic
1118469812 14:66065458-66065480 CATTAGACTGAGAAGGGGCTGGG + Intergenic
1119796367 14:77401398-77401420 CAAAAGACTCAGAACAGGCTGGG + Intronic
1119877178 14:78070899-78070921 CAGAAGCCTCTGAAGCAGCTTGG - Intergenic
1120541693 14:85759118-85759140 CAGTACATTCAGAAGTAGCTTGG - Intergenic
1120627632 14:86848615-86848637 CAGTGGATTCAGAAGAGGATGGG + Intergenic
1121529425 14:94641813-94641835 CAGCAGACCCAGGGGAAGCTCGG + Intergenic
1122497324 14:102167518-102167540 CAGTATATTAAGAAGAATCTAGG - Intronic
1122879514 14:104683847-104683869 CTGCAGACTCAGAAGAGGCAGGG - Intergenic
1123147375 14:106146147-106146169 CAGGAGAGTCATCAGAAGCTGGG + Intergenic
1123476269 15:20594180-20594202 CAGAAGAGTCAGAAGATGCTGGG - Intergenic
1123641743 15:22406184-22406206 CAGAAGAGTCAGAAGATGCTGGG + Intergenic
1123891052 15:24780061-24780083 CAGTAGAATCAGTTGAACCTGGG - Intergenic
1126793562 15:52242177-52242199 CAGTGGCCTTAAAAGAAGCTTGG - Exonic
1126798247 15:52277766-52277788 CTGATGACTCTGAAGAAGCTCGG + Intronic
1127814204 15:62592211-62592233 CAGGACTCTCAGAAGCAGCTAGG - Intronic
1128717151 15:69917014-69917036 CAGGAAGCTCACAAGAAGCTGGG - Intergenic
1129775942 15:78236568-78236590 CAGGTGACTGAGAAAAAGCTGGG + Intronic
1130897934 15:88184983-88185005 CTGAAGTCTCAGATGAAGCTAGG - Intronic
1131428983 15:92371078-92371100 GATTAGTCTCAGAGGAAGCTGGG + Intergenic
1132253728 15:100355529-100355551 CAGTGGACTCTGAAGATCCTTGG - Intergenic
1132322446 15:100935909-100935931 CAGTAGGCTGTAAAGAAGCTTGG - Intronic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1134768069 16:16779974-16779996 CCGTAGCCTCAGGAGTAGCTGGG - Intergenic
1135787583 16:25364193-25364215 AAGGAGACCCAGAAGAAACTAGG + Intergenic
1135886995 16:26319303-26319325 CAGGAGACTCACTAGAACCTGGG - Intergenic
1136691364 16:32033297-32033319 CAGGAGAATCATCAGAAGCTGGG - Intergenic
1136772672 16:32855506-32855528 CAGGAGAGTCATCAGAAGCTGGG - Intergenic
1136791952 16:32976862-32976884 CAGGAGAATCATCAGAAGCTGGG - Intergenic
1136877865 16:33877046-33877068 CAGGAGAATCATCAGAAGCTGGG + Intergenic
1136897942 16:34006013-34006035 CAGGAGAGTCATCAGAAGCTGGG + Intergenic
1138126988 16:54447239-54447261 CCTTAGACTCACAAGTAGCTAGG + Intergenic
1138462146 16:57155854-57155876 CATTAGCCTCACAAGTAGCTGGG - Intronic
1139436733 16:66940876-66940898 CAGGAGCCACAGAACAAGCTCGG - Intronic
1139563486 16:67758382-67758404 CAGGAGGCTCAAAAGGAGCTCGG - Intronic
1139620848 16:68140951-68140973 TTGTAGACTCAGAAGAGGGTAGG - Intronic
1140558781 16:75953204-75953226 AAGTATACTGAGAAGGAGCTAGG + Intergenic
1140809110 16:78559928-78559950 ACGTAGATTCAGGAGAAGCTGGG - Intronic
1203075097 16_KI270728v1_random:1117616-1117638 CAGGAGAGTCATCAGAAGCTGGG - Intergenic
1203094163 16_KI270728v1_random:1238326-1238348 CAGGAGAATCATCAGAAGCTGGG - Intergenic
1142797449 17:2319652-2319674 CGGTAGACACAGAAGCAGTTGGG - Intronic
1142841521 17:2635068-2635090 CAGGAGAATCACTAGAAGCTGGG + Intronic
1142909987 17:3080730-3080752 TAGAAGACTCAGAAGAAGAGAGG - Intergenic
1143426491 17:6843472-6843494 CAGTAGGCTCAGAAGAGCCAAGG + Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1149047526 17:52265175-52265197 CAGAAGACTCAGAAGAGTCTGGG + Intergenic
1149519752 17:57309871-57309893 CAATAGATTCAGAAGCAGCCTGG + Intronic
1149776777 17:59364474-59364496 CATTAGACTCAGAAGACGCAGGG - Intronic
1150963997 17:69947036-69947058 CAGTGGAATGGGAAGAAGCTGGG + Intergenic
1151302738 17:73239885-73239907 TAGTAGAGTCAGACGAACCTGGG - Intronic
1151473749 17:74333453-74333475 CAGAAGACTCACTAGAACCTGGG - Intronic
1152220641 17:79063328-79063350 CACTACACTCCGAAGAAGCCTGG - Intergenic
1152299043 17:79484819-79484841 CAGCAGGCTCAGAGGAGGCTAGG - Intronic
1154369231 18:13743530-13743552 CTGTAGACACAGGAAAAGCTGGG + Intronic
1155136455 18:22998722-22998744 AAGTAGATTCAAAAGAAGCCAGG - Intronic
1155487535 18:26362130-26362152 CTTTAGACTCAGAAAAATCTGGG + Intronic
1158544783 18:58386782-58386804 CAGCACACTCAGAAACAGCTCGG + Intronic
1158715756 18:59878122-59878144 CAGGAGACTCACTTGAAGCTGGG + Intergenic
1160317414 18:77860259-77860281 GAGAAGACTCTGAAGAAGCCTGG + Intergenic
1162459744 19:10807639-10807661 CAGGAGAATCACACGAAGCTAGG - Intronic
1162522153 19:11187790-11187812 CAATAAAATCAGAAAAAGCTGGG + Intronic
1166863760 19:45824026-45824048 CAGGAGAGTCAGAAGAACCTTGG + Intronic
1167193478 19:48008838-48008860 CAAAAATCTCAGAAGAAGCTGGG + Intronic
1167322772 19:48806668-48806690 CAGAAGCCTCATAAGAAGCCTGG - Exonic
1167536653 19:50057576-50057598 CATTAGCCTCCCAAGAAGCTGGG - Intergenic
925302210 2:2825519-2825541 CAGCAGACTCTGAAGAAACTGGG + Intergenic
925854706 2:8118340-8118362 CAGTATTCTTAGAGGAAGCTTGG - Intergenic
926178633 2:10619711-10619733 CAGTGGACTTTGAAGAAGATTGG - Intronic
926773256 2:16397059-16397081 AAGTAGAGTCAGATGAAGATGGG + Intergenic
926807668 2:16726201-16726223 CAGAAGAATCAGAAGAGGCAAGG - Intergenic
926860606 2:17304764-17304786 CAGTCGACCCAGAAGAAGACAGG + Intergenic
928588781 2:32791757-32791779 CTGTAGCCTCACAAGTAGCTGGG - Intronic
928690831 2:33797092-33797114 CTCTTAACTCAGAAGAAGCTGGG + Intergenic
930190093 2:48449301-48449323 CAGTAGCCTCAGAAGAAGGAAGG + Intronic
930294040 2:49530929-49530951 CAGAAGGCTCAGAAGAAGGAGGG - Intergenic
930994375 2:57698589-57698611 CAGCAGACTCAGAGGATGCAGGG + Intergenic
932343914 2:70983486-70983508 CAGAAAACTCAGAAGATACTGGG + Intronic
932935773 2:76099275-76099297 CAGAGGGCTCAGAAGAAGATAGG - Intergenic
933485347 2:82915168-82915190 AAGAAGACTTAGAAGAAGCAGGG - Intergenic
934559342 2:95304545-95304567 CAGCTGACTCAGAACAGGCTGGG + Intronic
934603292 2:95675211-95675233 CCTTAGACTCCGAAGTAGCTAGG + Intergenic
935272747 2:101449199-101449221 AAGTGGAGTCAGAAGAAACTTGG + Intronic
935588854 2:104826538-104826560 CAGTAGATGCAGCAGAAGCAAGG - Intergenic
939146761 2:138425025-138425047 AAGCAGGCTCAGAAGCAGCTGGG + Intergenic
939547940 2:143576669-143576691 CAGAAGAATCAGAAGAAGGGAGG + Intronic
940287493 2:152047151-152047173 CATTAGACTCACGAGATGCTTGG + Intronic
940527479 2:154835166-154835188 AAGTAGGCTCAGAAAAATCTTGG + Intronic
940684930 2:156836222-156836244 AACAAGACTCAGAAGAAACTTGG + Intergenic
943271450 2:185810755-185810777 TAGAAGGCTCAGAAGAAGATAGG + Intronic
943472010 2:188305868-188305890 CAGGAGACTCACATGAACCTGGG - Intronic
944443907 2:199770292-199770314 AAGTCGACTAAGAAGAAACTAGG + Intronic
945073322 2:206012751-206012773 CAGTAGCCTCCCAAGTAGCTGGG - Intronic
945155691 2:206834958-206834980 CAGAAGATTCAGAAAAATCTGGG + Intergenic
945793582 2:214334361-214334383 CAGAAGGCTCAGAGGAATCTGGG + Intronic
946031834 2:216711483-216711505 CAGAAGACTCAGCAGAAACCCGG - Intergenic
946056091 2:216903187-216903209 CAGAGGACTCAGAAGAAGGCAGG - Intergenic
946411130 2:219515683-219515705 CAGTAGCCTCAGAAGAAAAAGGG - Intronic
946479532 2:220040798-220040820 CAGGAGACCCAGAAGGAGCAAGG - Intergenic
948296736 2:236866235-236866257 TGGAAGACTCAGAAGAAGATAGG - Intergenic
949034493 2:241810321-241810343 CAGATGAGTCAGAAGGAGCTGGG + Intronic
1169253884 20:4083051-4083073 CAGTGGTCTCAGAGGAAGCCTGG - Intergenic
1172787730 20:37480255-37480277 CAGTAGACCCAGGAGACGCCTGG + Intergenic
1173395468 20:42675681-42675703 CAGTAGACTCAGCAGATACCTGG + Intronic
1173882292 20:46424640-46424662 CAGTAGCAGCAGAAGAACCTGGG + Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175195483 20:57240460-57240482 TGGAAGACTCAGAAGAAGATAGG - Intronic
1175567341 20:59990960-59990982 CAGGAGAATCACAAGAACCTGGG - Intronic
1177220352 21:18184738-18184760 CAGTTGACATAGAAGAAGGTTGG - Intronic
1177560484 21:22744486-22744508 CAGAAGACTAAGAAGAAGCAAGG + Intergenic
1177940521 21:27404967-27404989 AAGTATATTCTGAAGAAGCTGGG + Intergenic
1184574314 22:45350065-45350087 CAGCAGACTCAGAAAAAGCAGGG - Intronic
949187801 3:1214727-1214749 AAGAAAACTCAGAATAAGCTGGG - Intronic
949901058 3:8815077-8815099 GAGTAGACACAGAAGAGGCGGGG + Intronic
951661446 3:25071011-25071033 CTCAAGACTCAGAAGAAGCATGG - Intergenic
952977195 3:38706616-38706638 CAGAAGACTGAGAAGAACTTAGG + Intronic
953386872 3:42511633-42511655 CAGGAGAATCAGGAGACGCTGGG + Intronic
953459760 3:43072984-43073006 CAGTGGACTTGGAAGAGGCTGGG + Intergenic
953521973 3:43651903-43651925 GAGTAGAACCAGAAGAAGATGGG - Intronic
953589699 3:44239729-44239751 CCGTAGCCTCAGGAGTAGCTGGG - Intergenic
955246023 3:57225970-57225992 CAGGAGACTCAGTTGAAGCCGGG - Intronic
955368483 3:58331802-58331824 CAGTAGACTGGGAAGGGGCTTGG - Intergenic
955821907 3:62905474-62905496 CAGAAGACTCAGGAGAAGTCTGG + Intergenic
959566070 3:107834484-107834506 CACAAGACTAAGAAGAAGCAGGG + Intergenic
959584031 3:108009234-108009256 CAGTAGACACAGAAGCACCCAGG + Intergenic
960433550 3:117598997-117599019 CAGGACACTGAGAAGAAGTTAGG - Intergenic
961705904 3:128785036-128785058 CAGGAGACTCACTAGAACCTGGG - Intronic
963850714 3:150207901-150207923 CAGTAGACGCTTAAGAAGCGGGG + Intergenic
963942851 3:151112403-151112425 CATTAGACTTTGAAGAAGCAGGG - Intronic
964055908 3:152457177-152457199 AAGTAGAATCAGAAAATGCTGGG - Intronic
964897478 3:161615102-161615124 CAGTCACATCAGAAGAAGCTAGG - Intergenic
965292353 3:166899661-166899683 TAGAAGACTCAGAGGAAGCAGGG - Intergenic
966718679 3:183039393-183039415 AAGAAGATTCAGAAGAAGATAGG - Intronic
969840439 4:9877809-9877831 CAGCAGACCCAGAAGAGCCTGGG - Intronic
970031676 4:11683219-11683241 CACAAGACTCAAAAGAAGCAGGG + Intergenic
972107450 4:35507711-35507733 CAATTTACTAAGAAGAAGCTGGG + Intergenic
972684990 4:41343699-41343721 CAGGAGACTCACTTGAAGCTAGG - Intergenic
974091993 4:57321309-57321331 AAGTAGAGTCAGTAGATGCTGGG - Intergenic
974637912 4:64589601-64589623 CAGAAGACTCAGAAGAAAACAGG + Intergenic
974758307 4:66242461-66242483 CAGTAGAATCACGAGAACCTGGG - Intergenic
978617202 4:110609916-110609938 CAGTGGCCTTTGAAGAAGCTAGG + Intergenic
980663504 4:135898674-135898696 CAGAAGGCTCAGAAGAAGATAGG + Intergenic
986618188 5:9641641-9641663 CAGTAGATTCAGAGGAAGGCTGG - Intronic
989163962 5:38416833-38416855 TAGTAGACTCAACACAAGCTAGG - Intronic
990849340 5:60183952-60183974 CAGTGGATTCTCAAGAAGCTAGG + Intronic
991976424 5:72187767-72187789 CAGGTGACTCAGATGAAGTTGGG - Intronic
993208707 5:84920759-84920781 TAGAGGACTCAGAAGAAGATAGG + Intergenic
994669980 5:102753911-102753933 CAGTGGACTGGGAAGAAGGTAGG - Intergenic
994806420 5:104452718-104452740 CACTAGACTCAGAGAAAGCAAGG + Intergenic
994918619 5:106012337-106012359 CAGAGGGCTCAGAAGAAGGTAGG - Intergenic
995446374 5:112248741-112248763 CAGTACCCTTAGAAGAAGCTAGG - Intronic
996305052 5:122037191-122037213 CACTAGACTCACAGGAGGCTGGG - Intronic
996918879 5:128743804-128743826 CAGCAGCCTCCCAAGAAGCTGGG - Intronic
997999096 5:138610073-138610095 CAGCTCACTCAGAGGAAGCTGGG + Intergenic
998391894 5:141792535-141792557 CAGGAGAATCACTAGAAGCTGGG + Intergenic
1000918849 5:167115180-167115202 AAGGAGACTCCGAAGAAGTTAGG + Intergenic
1002254979 5:177951921-177951943 CAGGACACTTAGAAGAAGCATGG + Intergenic
1002607186 5:180390358-180390380 GAGGAGAAACAGAAGAAGCTCGG - Intergenic
1003052689 6:2794039-2794061 CAGTAGGCTCTGAGGAAGCCAGG + Intergenic
1003331463 6:5132754-5132776 GAGTAAACTCAAAAGAAACTGGG - Intronic
1004707085 6:18134600-18134622 CAATAGACTGAGCAGAAGCCAGG + Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1007171916 6:39870123-39870145 CAGGAGACCTAAAAGAAGCTGGG + Intronic
1007975374 6:46095754-46095776 TAGAAGGCTCAGAAGAAGATAGG - Intergenic
1008415282 6:51232810-51232832 CCTTAGACTCACAAGTAGCTAGG - Intergenic
1011141252 6:84159807-84159829 CAGGAGAATCACATGAAGCTAGG - Intronic
1011493359 6:87915239-87915261 CAGAAGAAGCAGAACAAGCTGGG - Intergenic
1011690975 6:89868885-89868907 CAGTATTCTCACAAGAATCTTGG - Exonic
1013192736 6:107817499-107817521 AAGTAGATTCCCAAGAAGCTGGG - Intronic
1017166320 6:151411486-151411508 CAGTAGAGGCAGAAGGGGCTTGG + Intronic
1017502415 6:155037850-155037872 CAGTGGACACAGAAGAAGTAAGG - Intronic
1018221932 6:161589893-161589915 CAGCAGCCTCACAAGTAGCTGGG + Intronic
1019536628 7:1532794-1532816 CTTTAGACTCAGAAACAGCTGGG - Intronic
1021778776 7:24080822-24080844 AAGTCCACTCTGAAGAAGCTAGG - Intergenic
1022122869 7:27326768-27326790 CAGTAGCCTCCCAAGTAGCTGGG + Intergenic
1022168190 7:27794397-27794419 CAGTAGAGGCAGAAGTGGCTGGG - Exonic
1023471005 7:40519552-40519574 CAGTAGACACAGAAAATTCTTGG + Intronic
1027990916 7:85360121-85360143 CAGAGGACTCAGAAGAAGACAGG + Intergenic
1029803665 7:102975426-102975448 CAGTAGGCTGAGCAGGAGCTTGG - Intronic
1030149688 7:106391370-106391392 AAGCAGACTTAAAAGAAGCTGGG - Intergenic
1030520925 7:110596949-110596971 GGATAGACTCGGAAGAAGCTGGG - Intergenic
1030695724 7:112582795-112582817 CAGTAGCCTCAGAACCATCTGGG - Intergenic
1032718755 7:134533089-134533111 CAGCACACTTAGAGGAAGCTGGG - Intronic
1033274933 7:139964639-139964661 TAGTAGACACAGCAGAGGCTAGG + Intronic
1033776829 7:144620656-144620678 CAGAAGACTCAGAAGAGGAGAGG + Intronic
1033861231 7:145630618-145630640 AGGAAGAATCAGAAGAAGCTGGG - Intergenic
1035009531 7:155701778-155701800 CAGAAGACTCAGTTGAACCTGGG - Intronic
1037011362 8:13846641-13846663 AAGTAGACTAAGATGAACCTGGG - Intergenic
1038456885 8:27678669-27678691 TGCTAGACTCAGAAGAAGTTTGG - Intergenic
1038812944 8:30869716-30869738 AAGTAGACTCACAAGGAGATAGG - Intronic
1040563710 8:48547167-48547189 CAGAAAACTCAGAAGTAGCTAGG + Intergenic
1042730004 8:71922444-71922466 CAGCACACTTCGAAGAAGCTGGG + Intronic
1044463478 8:92476041-92476063 CAGTGGACTCAGAAAAAGACTGG + Intergenic
1045629062 8:104095260-104095282 CAGAAAACTAAGAAGAAGCAAGG - Intronic
1045691909 8:104767936-104767958 CATTAGATTCAGAAAATGCTAGG + Intronic
1045785655 8:105917907-105917929 TAGAAGACTCAGAAGAAGATAGG + Intergenic
1046233104 8:111383698-111383720 CAGTAGATCCAGAAAAAGCATGG - Intergenic
1047530913 8:125674497-125674519 CAGAAGCCTCAGAAGAGGCAAGG - Intergenic
1047607532 8:126489862-126489884 CTGCAGACTCAGAAGAGACTTGG - Intergenic
1048769215 8:137877634-137877656 CAGTAGAATCACCAGAACCTGGG + Intergenic
1052357253 9:27517902-27517924 AGGTAGCCTGAGAAGAAGCTTGG - Intronic
1052630849 9:31036602-31036624 CCATAGCCTCAGAAGTAGCTGGG - Intergenic
1055165094 9:73181797-73181819 CAGTGGAGTCAGAAGACACTGGG - Intergenic
1056581012 9:87888061-87888083 CAGAAGAGTCAGAAGACGCTGGG + Exonic
1057523849 9:95782866-95782888 CACAAGTCTCAGAAGATGCTTGG + Intergenic
1058209128 9:102145447-102145469 AATTAGACTCAGAAGAACCAGGG - Intergenic
1060536849 9:124396803-124396825 AAGTAGTGTCAGAAGAAGCTTGG - Intronic
1060709091 9:125838343-125838365 AAGTAGACTTAGAAGACGCCAGG - Intronic
1061622978 9:131823783-131823805 CAGACGACACAGACGAAGCTGGG - Intergenic
1187089468 X:16080193-16080215 CAGTAAACCCAGAAGAACTTAGG + Intergenic
1187337013 X:18390285-18390307 CAGGAGAATCAGCAGAACCTGGG - Intergenic
1189656455 X:43249720-43249742 CACTAGACTAAGAAGAAGTTTGG + Intergenic
1190805122 X:53827836-53827858 CACTAGACTCACAAGTAGCTAGG - Intergenic
1192779357 X:74278445-74278467 CAGGAGAATCAGATGAACCTGGG - Intergenic
1193198872 X:78664993-78665015 TAGAAGGCTCAGAAGAAGATAGG + Intergenic
1193938584 X:87652726-87652748 TGGAAGACTCAGAAGAAGATAGG - Intronic
1194168819 X:90556530-90556552 CAGTGGGCTCAGAAGAAGATAGG + Intergenic
1194280732 X:91950306-91950328 TAGGAGACTCAGAAGAAGAGAGG - Intronic
1196360042 X:114842613-114842635 CAGAATGCTCAGAAGAAGCCTGG + Intronic
1196491292 X:116270378-116270400 AAGTAGACTGAGAAAAAGGTAGG - Intergenic
1197073452 X:122327288-122327310 TAGTAGTCTGAGAAGATGCTTGG - Intergenic
1198168977 X:134086180-134086202 CTGTAGTCTGAGAAGATGCTTGG - Intergenic
1200598216 Y:5173862-5173884 TAGGAGACTCAGAAGAAGAGAGG - Intronic
1202172423 Y:22064971-22064993 CAGTAGACTCAGAAACATTTTGG + Intergenic
1202218940 Y:22521400-22521422 CAGTAGACTCAGAAACATTTTGG - Intergenic
1202324246 Y:23674651-23674673 CAGTAGACTCAGAAACATTTTGG + Intergenic
1202546525 Y:25995403-25995425 CAGTAGACTCAGAAACATTTTGG - Intergenic