ID: 1067300846

View in Genome Browser
Species Human (GRCh38)
Location 10:45007799-45007821
Sequence CTTAAATCCCAGAGAGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067300844_1067300846 9 Left 1067300844 10:45007767-45007789 CCAATTTAAATGAAGCTTCTGAG No data
Right 1067300846 10:45007799-45007821 CTTAAATCCCAGAGAGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067300846 Original CRISPR CTTAAATCCCAGAGAGAACC TGG Intergenic
No off target data available for this crispr