ID: 1067313192

View in Genome Browser
Species Human (GRCh38)
Location 10:45134669-45134691
Sequence CAAGTCAATCCATTCATTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067313192_1067313198 20 Left 1067313192 10:45134669-45134691 CCATGAATGAATGGATTGACTTG No data
Right 1067313198 10:45134712-45134734 ATTTTGCAAGGGAAGTCTGAAGG No data
1067313192_1067313194 -4 Left 1067313192 10:45134669-45134691 CCATGAATGAATGGATTGACTTG No data
Right 1067313194 10:45134688-45134710 CTTGAACACAACCACGGAGTTGG No data
1067313192_1067313196 8 Left 1067313192 10:45134669-45134691 CCATGAATGAATGGATTGACTTG No data
Right 1067313196 10:45134700-45134722 CACGGAGTTGGTATTTTGCAAGG 0: 2
1: 1
2: 0
3: 2
4: 140
1067313192_1067313193 -10 Left 1067313192 10:45134669-45134691 CCATGAATGAATGGATTGACTTG No data
Right 1067313193 10:45134682-45134704 GATTGACTTGAACACAACCACGG No data
1067313192_1067313197 9 Left 1067313192 10:45134669-45134691 CCATGAATGAATGGATTGACTTG No data
Right 1067313197 10:45134701-45134723 ACGGAGTTGGTATTTTGCAAGGG 0: 2
1: 0
2: 0
3: 13
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067313192 Original CRISPR CAAGTCAATCCATTCATTCA TGG (reversed) Intergenic
No off target data available for this crispr