ID: 1067313194

View in Genome Browser
Species Human (GRCh38)
Location 10:45134688-45134710
Sequence CTTGAACACAACCACGGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067313192_1067313194 -4 Left 1067313192 10:45134669-45134691 CCATGAATGAATGGATTGACTTG No data
Right 1067313194 10:45134688-45134710 CTTGAACACAACCACGGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067313194 Original CRISPR CTTGAACACAACCACGGAGT TGG Intergenic
No off target data available for this crispr