ID: 1067315285

View in Genome Browser
Species Human (GRCh38)
Location 10:45155683-45155705
Sequence CTCAAAGACAAGTGCATTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067315285_1067315290 12 Left 1067315285 10:45155683-45155705 CCTCCAATGCACTTGTCTTTGAG No data
Right 1067315290 10:45155718-45155740 GACACCCAAGAGTTACCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067315285 Original CRISPR CTCAAAGACAAGTGCATTGG AGG (reversed) Intergenic
No off target data available for this crispr