ID: 1067317145

View in Genome Browser
Species Human (GRCh38)
Location 10:45179831-45179853
Sequence GTGGCAGGCCGGTTTTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067317134_1067317145 29 Left 1067317134 10:45179779-45179801 CCTAAAATGCTTGCTGAAAAGTC No data
Right 1067317145 10:45179831-45179853 GTGGCAGGCCGGTTTTTTGGAGG No data
1067317136_1067317145 7 Left 1067317136 10:45179801-45179823 CCGGCAAGATGAATATGACTTGG No data
Right 1067317145 10:45179831-45179853 GTGGCAGGCCGGTTTTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067317145 Original CRISPR GTGGCAGGCCGGTTTTTTGG AGG Intergenic
No off target data available for this crispr