ID: 1067319657

View in Genome Browser
Species Human (GRCh38)
Location 10:45205738-45205760
Sequence GGCGCGAGCCAAGGAAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067319657_1067319669 3 Left 1067319657 10:45205738-45205760 CCTGCTCTTCCTTGGCTCGCGCC No data
Right 1067319669 10:45205764-45205786 GGCACTGGGTTGAGGGGTCTGGG No data
1067319657_1067319670 21 Left 1067319657 10:45205738-45205760 CCTGCTCTTCCTTGGCTCGCGCC No data
Right 1067319670 10:45205782-45205804 CTGGGCACTGTGCAGCCGCCAGG No data
1067319657_1067319668 2 Left 1067319657 10:45205738-45205760 CCTGCTCTTCCTTGGCTCGCGCC No data
Right 1067319668 10:45205763-45205785 GGGCACTGGGTTGAGGGGTCTGG No data
1067319657_1067319663 -5 Left 1067319657 10:45205738-45205760 CCTGCTCTTCCTTGGCTCGCGCC No data
Right 1067319663 10:45205756-45205778 GCGCCCAGGGCACTGGGTTGAGG No data
1067319657_1067319671 25 Left 1067319657 10:45205738-45205760 CCTGCTCTTCCTTGGCTCGCGCC No data
Right 1067319671 10:45205786-45205808 GCACTGTGCAGCCGCCAGGATGG No data
1067319657_1067319672 26 Left 1067319657 10:45205738-45205760 CCTGCTCTTCCTTGGCTCGCGCC No data
Right 1067319672 10:45205787-45205809 CACTGTGCAGCCGCCAGGATGGG No data
1067319657_1067319673 27 Left 1067319657 10:45205738-45205760 CCTGCTCTTCCTTGGCTCGCGCC No data
Right 1067319673 10:45205788-45205810 ACTGTGCAGCCGCCAGGATGGGG No data
1067319657_1067319664 -4 Left 1067319657 10:45205738-45205760 CCTGCTCTTCCTTGGCTCGCGCC No data
Right 1067319664 10:45205757-45205779 CGCCCAGGGCACTGGGTTGAGGG No data
1067319657_1067319665 -3 Left 1067319657 10:45205738-45205760 CCTGCTCTTCCTTGGCTCGCGCC No data
Right 1067319665 10:45205758-45205780 GCCCAGGGCACTGGGTTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067319657 Original CRISPR GGCGCGAGCCAAGGAAGAGC AGG (reversed) Intergenic
No off target data available for this crispr