ID: 1067324474

View in Genome Browser
Species Human (GRCh38)
Location 10:45253818-45253840
Sequence GCTCCCAACTCAAGAACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067324474_1067324478 20 Left 1067324474 10:45253818-45253840 CCCTGGGTTCTTGAGTTGGGAGC No data
Right 1067324478 10:45253861-45253883 CTTTTTTAATATATGTACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067324474 Original CRISPR GCTCCCAACTCAAGAACCCA GGG (reversed) Intergenic
No off target data available for this crispr