ID: 1067328581

View in Genome Browser
Species Human (GRCh38)
Location 10:45293136-45293158
Sequence CTGAGGGTCCTGAGTTCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067328581_1067328592 22 Left 1067328581 10:45293136-45293158 CCCAAGGAACTCAGGACCCTCAG No data
Right 1067328592 10:45293181-45293203 ACCTGAGCACAGAGGGAAGCAGG No data
1067328581_1067328591 15 Left 1067328581 10:45293136-45293158 CCCAAGGAACTCAGGACCCTCAG No data
Right 1067328591 10:45293174-45293196 GGCAGCTACCTGAGCACAGAGGG No data
1067328581_1067328588 -6 Left 1067328581 10:45293136-45293158 CCCAAGGAACTCAGGACCCTCAG No data
Right 1067328588 10:45293153-45293175 CCTCAGGTCTGGACCGGCTCAGG No data
1067328581_1067328590 14 Left 1067328581 10:45293136-45293158 CCCAAGGAACTCAGGACCCTCAG No data
Right 1067328590 10:45293173-45293195 AGGCAGCTACCTGAGCACAGAGG No data
1067328581_1067328594 25 Left 1067328581 10:45293136-45293158 CCCAAGGAACTCAGGACCCTCAG No data
Right 1067328594 10:45293184-45293206 TGAGCACAGAGGGAAGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067328581 Original CRISPR CTGAGGGTCCTGAGTTCCTT GGG (reversed) Intergenic
No off target data available for this crispr