ID: 1067328582

View in Genome Browser
Species Human (GRCh38)
Location 10:45293137-45293159
Sequence CCTGAGGGTCCTGAGTTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067328582_1067328588 -7 Left 1067328582 10:45293137-45293159 CCAAGGAACTCAGGACCCTCAGG No data
Right 1067328588 10:45293153-45293175 CCTCAGGTCTGGACCGGCTCAGG No data
1067328582_1067328592 21 Left 1067328582 10:45293137-45293159 CCAAGGAACTCAGGACCCTCAGG No data
Right 1067328592 10:45293181-45293203 ACCTGAGCACAGAGGGAAGCAGG No data
1067328582_1067328591 14 Left 1067328582 10:45293137-45293159 CCAAGGAACTCAGGACCCTCAGG No data
Right 1067328591 10:45293174-45293196 GGCAGCTACCTGAGCACAGAGGG No data
1067328582_1067328594 24 Left 1067328582 10:45293137-45293159 CCAAGGAACTCAGGACCCTCAGG No data
Right 1067328594 10:45293184-45293206 TGAGCACAGAGGGAAGCAGGAGG No data
1067328582_1067328595 30 Left 1067328582 10:45293137-45293159 CCAAGGAACTCAGGACCCTCAGG No data
Right 1067328595 10:45293190-45293212 CAGAGGGAAGCAGGAGGATGTGG No data
1067328582_1067328590 13 Left 1067328582 10:45293137-45293159 CCAAGGAACTCAGGACCCTCAGG No data
Right 1067328590 10:45293173-45293195 AGGCAGCTACCTGAGCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067328582 Original CRISPR CCTGAGGGTCCTGAGTTCCT TGG (reversed) Intergenic
No off target data available for this crispr