ID: 1067328586

View in Genome Browser
Species Human (GRCh38)
Location 10:45293152-45293174
Sequence CTGAGCCGGTCCAGACCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067328586_1067328594 9 Left 1067328586 10:45293152-45293174 CCCTCAGGTCTGGACCGGCTCAG No data
Right 1067328594 10:45293184-45293206 TGAGCACAGAGGGAAGCAGGAGG No data
1067328586_1067328595 15 Left 1067328586 10:45293152-45293174 CCCTCAGGTCTGGACCGGCTCAG No data
Right 1067328595 10:45293190-45293212 CAGAGGGAAGCAGGAGGATGTGG No data
1067328586_1067328590 -2 Left 1067328586 10:45293152-45293174 CCCTCAGGTCTGGACCGGCTCAG No data
Right 1067328590 10:45293173-45293195 AGGCAGCTACCTGAGCACAGAGG No data
1067328586_1067328591 -1 Left 1067328586 10:45293152-45293174 CCCTCAGGTCTGGACCGGCTCAG No data
Right 1067328591 10:45293174-45293196 GGCAGCTACCTGAGCACAGAGGG No data
1067328586_1067328592 6 Left 1067328586 10:45293152-45293174 CCCTCAGGTCTGGACCGGCTCAG No data
Right 1067328592 10:45293181-45293203 ACCTGAGCACAGAGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067328586 Original CRISPR CTGAGCCGGTCCAGACCTGA GGG (reversed) Intergenic
No off target data available for this crispr