ID: 1067328588

View in Genome Browser
Species Human (GRCh38)
Location 10:45293153-45293175
Sequence CCTCAGGTCTGGACCGGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067328581_1067328588 -6 Left 1067328581 10:45293136-45293158 CCCAAGGAACTCAGGACCCTCAG No data
Right 1067328588 10:45293153-45293175 CCTCAGGTCTGGACCGGCTCAGG No data
1067328582_1067328588 -7 Left 1067328582 10:45293137-45293159 CCAAGGAACTCAGGACCCTCAGG No data
Right 1067328588 10:45293153-45293175 CCTCAGGTCTGGACCGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067328588 Original CRISPR CCTCAGGTCTGGACCGGCTC AGG Intergenic
No off target data available for this crispr