ID: 1067328589

View in Genome Browser
Species Human (GRCh38)
Location 10:45293166-45293188
Sequence GCTCAGGTAGCTGCCTGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067328589_1067328595 1 Left 1067328589 10:45293166-45293188 CCGGCTCAGGCAGCTACCTGAGC No data
Right 1067328595 10:45293190-45293212 CAGAGGGAAGCAGGAGGATGTGG No data
1067328589_1067328594 -5 Left 1067328589 10:45293166-45293188 CCGGCTCAGGCAGCTACCTGAGC No data
Right 1067328594 10:45293184-45293206 TGAGCACAGAGGGAAGCAGGAGG No data
1067328589_1067328592 -8 Left 1067328589 10:45293166-45293188 CCGGCTCAGGCAGCTACCTGAGC No data
Right 1067328592 10:45293181-45293203 ACCTGAGCACAGAGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067328589 Original CRISPR GCTCAGGTAGCTGCCTGAGC CGG (reversed) Intergenic
No off target data available for this crispr