ID: 1067328595

View in Genome Browser
Species Human (GRCh38)
Location 10:45293190-45293212
Sequence CAGAGGGAAGCAGGAGGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067328589_1067328595 1 Left 1067328589 10:45293166-45293188 CCGGCTCAGGCAGCTACCTGAGC No data
Right 1067328595 10:45293190-45293212 CAGAGGGAAGCAGGAGGATGTGG No data
1067328587_1067328595 14 Left 1067328587 10:45293153-45293175 CCTCAGGTCTGGACCGGCTCAGG No data
Right 1067328595 10:45293190-45293212 CAGAGGGAAGCAGGAGGATGTGG No data
1067328586_1067328595 15 Left 1067328586 10:45293152-45293174 CCCTCAGGTCTGGACCGGCTCAG No data
Right 1067328595 10:45293190-45293212 CAGAGGGAAGCAGGAGGATGTGG No data
1067328582_1067328595 30 Left 1067328582 10:45293137-45293159 CCAAGGAACTCAGGACCCTCAGG No data
Right 1067328595 10:45293190-45293212 CAGAGGGAAGCAGGAGGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067328595 Original CRISPR CAGAGGGAAGCAGGAGGATG TGG Intergenic
No off target data available for this crispr