ID: 1067332353

View in Genome Browser
Species Human (GRCh38)
Location 10:45333919-45333941
Sequence GAGGGTGAACTGAGGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067332353_1067332365 23 Left 1067332353 10:45333919-45333941 CCACCCTGCCTCAGTTCACCCTC No data
Right 1067332365 10:45333965-45333987 CCAGTCCAAATGAGATGAGCCGG No data
1067332353_1067332366 24 Left 1067332353 10:45333919-45333941 CCACCCTGCCTCAGTTCACCCTC No data
Right 1067332366 10:45333966-45333988 CAGTCCAAATGAGATGAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067332353 Original CRISPR GAGGGTGAACTGAGGCAGGG TGG (reversed) Intergenic
No off target data available for this crispr