ID: 1067332955

View in Genome Browser
Species Human (GRCh38)
Location 10:45338818-45338840
Sequence GAGGTCTCCTTGGGAAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067332955_1067332958 -7 Left 1067332955 10:45338818-45338840 CCATTTTTTCCCAAGGAGACCTC No data
Right 1067332958 10:45338834-45338856 AGACCTCCAGCCTTTTATCAAGG No data
1067332955_1067332965 14 Left 1067332955 10:45338818-45338840 CCATTTTTTCCCAAGGAGACCTC No data
Right 1067332965 10:45338855-45338877 GGTAACTGTGCATTGGGGAAAGG 0: 38
1: 156
2: 147
3: 111
4: 270
1067332955_1067332966 15 Left 1067332955 10:45338818-45338840 CCATTTTTTCCCAAGGAGACCTC No data
Right 1067332966 10:45338856-45338878 GTAACTGTGCATTGGGGAAAGGG 0: 42
1: 162
2: 135
3: 138
4: 310
1067332955_1067332963 8 Left 1067332955 10:45338818-45338840 CCATTTTTTCCCAAGGAGACCTC No data
Right 1067332963 10:45338849-45338871 TATCAAGGTAACTGTGCATTGGG No data
1067332955_1067332962 7 Left 1067332955 10:45338818-45338840 CCATTTTTTCCCAAGGAGACCTC No data
Right 1067332962 10:45338848-45338870 TTATCAAGGTAACTGTGCATTGG No data
1067332955_1067332964 9 Left 1067332955 10:45338818-45338840 CCATTTTTTCCCAAGGAGACCTC No data
Right 1067332964 10:45338850-45338872 ATCAAGGTAACTGTGCATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067332955 Original CRISPR GAGGTCTCCTTGGGAAAAAA TGG (reversed) Intergenic
No off target data available for this crispr